SeqAn 3.0.2
Despite all circumstances, we are excited to present a new update of our SeqAn library. We present some great new features and also a lot of usability improvements. Among others, this release will fully comply with the final C++-20 standard.
You can find a comprehensive list of the changes in our changelog.
- Get to know SeqAn3 with our tutorials.
- Visit our API documentation.
- See the porting guide for some help on porting from SeqAn2.
- Check out our new SeqAn3 Cookbook. It contains a listing of code
examples on how to perform particular tasks using the library.
Note that 3.1.0 will be the first API stable release and interfaces in this release might still change.
🎉 Notable new features
-
We added the
seqan3::views::minimiserandseqan3::views::minimiser_hashviews to compute the minimum in a shifted window and apply hashing, respectively. -
The
seqan3::search_cfg::hitconfiguration can now be set dynamically.Click for an example
#include <vector> #include <seqan3/alphabet/nucleotide/dna4.hpp> #include <seqan3/core/debug_stream.hpp> #include <seqan3/search/configuration/max_error.hpp> #include <seqan3/search/configuration/hit.hpp> #include <seqan3/search/fm_index/fm_index.hpp> #include <seqan3/search/search.hpp> int main() { using seqan3::operator""_dna4; std::vector<seqan3::dna4_vector> text{"CGCTGTCTGAAGGATGAGTGTCAGCCAGTGTA"_dna4, "ACCCGATGAGCTACCCAGTAGTCGAACTG"_dna4, "GGCCAGACAACCCGGCGCTAATGCACTCA"_dna4}; seqan3::dna4_vector query{"GCT"_dna4}; seqan3::fm_index index{text}; // Use the dynamic hit configuration to set hit_all_best mode. seqan3::configuration search_config = seqan3::search_cfg::max_error_total{seqan3::search_cfg::error_count{1}} | seqan3::search_cfg::hit{seqan3::search_cfg::hit_all_best{}}; seqan3::debug_stream << "All single best hits:\n"; for (auto && hit : search(query, index, search_config)) // Find all best hits: seqan3::debug_stream << hit << '\n'; // Change the hit configuration to the strata mode with a stratum of 1. using seqan3::get; get<seqan3::search_cfg::hit>(search_config).hit_variant = seqan3::search_cfg::hit_strata{1}; seqan3::debug_stream << "\nAll x+1 hits:\n"; for (auto && hit : search(query, index, search_config)) // Find all strata hits. seqan3::debug_stream << hit << '\n'; }
-
The return type of the search algorithm was adapted to use a lazy result range over the found hits during the search and is now independent of the used FM-index type.
Click for an example
#include <vector> #include <seqan3/alphabet/nucleotide/dna4.hpp> #include <seqan3/core/debug_stream.hpp> #include <seqan3/search/configuration/max_error.hpp> #include <seqan3/search/configuration/hit.hpp> #include <seqan3/search/search.hpp> #include <seqan3/search/fm_index/fm_index.hpp> int main() { using seqan3::operator""_dna4; std::vector<seqan3::dna4_vector> text{"CGCTGTCTGAAGGATGAGTGTCAGCCAGTGTA"_dna4, "ACCCGATGAGCTACCCAGTAGTCGAACTG"_dna4, "GGCCAGACAACCCGGCGCTAATGCACTCA"_dna4}; seqan3::dna4_vector query{"GCT"_dna4}; seqan3::configuration const search_config = seqan3::search_cfg::max_error_total{seqan3::search_cfg::error_count{1}} | seqan3::search_cfg::hit_all_best{}; // Always provide a unified interface over the found hits independent of the index its text layout. seqan3::debug_stream << "Search in text collection:\n"; seqan3::fm_index index_collection{text}; for (auto && hit : search(query, index_collection, search_config)) // Over a text collection. seqan3::debug_stream << hit << '\n'; seqan3::debug_stream << "\nSearch in single text:\n"; seqan3::fm_index index_single{text[0]}; for (auto && hit : search(query, index_single, search_config)) // Over a single text. seqan3::debug_stream << hit << '\n'; }
-
We added a data structure called interleaved Bloom filter, which can answer set-membership queries efficiently.
-
The pairwise alignment can now be configured with a user-defined callback, which is called for every computed alignment
result instead of returning a lazy range over the alignment results.Click for an example
#include <mutex> #include <vector> #include <seqan3/alignment/configuration/align_config_edit.hpp> #include <seqan3/alignment/configuration/align_config_method.hpp> #include <seqan3/alignment/configuration/align_config_on_result.hpp> #include <seqan3/alignment/configuration/align_config_parallel.hpp> #include <seqan3/alignment/pairwise/align_pairwise.hpp> #include <seqan3/alphabet/nucleotide/dna4.hpp> #include <seqan3/core/debug_stream.hpp> int main() { // Generate some sequences. using seqan3::operator""_dna4; using sequence_pair_t = std::pair<seqan3::dna4_vector, seqan3::dna4_vector>; std::vector<sequence_pair_t> sequences{100, {"AGTGCTACG"_dna4, "ACGTGCGACTAG"_dna4}}; std::mutex write_to_debug_stream{}; // Need mutex to synchronise the output. // Use edit distance with 4 threads. auto const alignment_config = seqan3::align_cfg::method_global{} | seqan3::align_cfg::edit_scheme | seqan3::align_cfg::parallel{4} | seqan3::align_cfg::on_result{[&] (auto && result) { std::lock_guard sync{write_to_debug_stream}; // critical section seqan3::debug_stream << result << '\n'; }}; // Compute the alignments in parallel, and output them unordered using the callback (order is not deterministic). seqan3::align_pairwise(sequences, alignment_config); // seqan3::align_pairwise is now declared void. }
Notable API changes
- The alignment and search configurations have been refactored and improved.
- Some type traits and concepts have been added to the seqan3/std module complying with the C++-20 standard.
🐛 Notable bug fixes
- FM-index based search produces now the correct results when using quality sequences.
- The parallel search was fixed. So no time for ☕ here, sorry.
- Fixed an issue with spawning too many threads in parallel pairwise alignment.
- Various fixes to make our views and ranges comply with the C++-20 standard.
🔌 External dependencies
- SeqAn 3.0.2 is known to compile with GCC 7.5, 8.4, 9.3 and 10.2. Future versions (e.g. GCC 10.3 and 11) might work,
but aren't yet available at the time of this release. - We now support ranges-v3 versions >= 0.11.0 and < 0.12.0, increasing the previous requirement of >= 0.10.0 and < 0.11.0.
Note: We changed our naming scheme of our source package from seqan-[VERSION]-with-submodules.tar.gz to seqan3-[VERSION]-Source.tar.xz. Please use the new package seqan3-[VERSION]-Source.tar.xz.