-
Notifications
You must be signed in to change notification settings - Fork 28
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
Showing
8 changed files
with
1,464 additions
and
0 deletions.
There are no files selected for viewing
5 changes: 5 additions & 0 deletions
5
...atasets/flu_h3n2_ha/references/EPI1857216/versions/2023-11-18T12:00:00Z/files/genemap.gff
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
##gff-version 3 | ||
##sequence-region EPI1857216 1 1718 | ||
EPI1857216 feature gene 1 48 . + . gene_name="SigPep" | ||
EPI1857216 feature gene 49 1035 . + . gene_name="HA1" | ||
EPI1857216 feature gene 1036 1698 . + . gene_name="HA2" |
1 change: 1 addition & 0 deletions
1
...atasets/flu_h3n2_ha/references/EPI1857216/versions/2023-11-18T12:00:00Z/files/primers.csv
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
Country (Institute),Target,Oligonucleotide,Sequence |
33 changes: 33 additions & 0 deletions
33
data/datasets/flu_h3n2_ha/references/EPI1857216/versions/2023-11-18T12:00:00Z/files/qc.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,33 @@ | ||
{ | ||
"schemaVersion": "1.2.0", | ||
"privateMutations": { | ||
"enabled": true, | ||
"typical": 5, | ||
"cutoff": 15, | ||
"weightLabeledSubstitutions": 2, | ||
"weightReversionSubstitutions": 1, | ||
"weightUnlabeledSubstitutions": 1 | ||
}, | ||
"missingData": { | ||
"enabled": false, | ||
"missingDataThreshold": 100, | ||
"scoreBias": 10 | ||
}, | ||
"snpClusters": { | ||
"enabled": false, | ||
"windowSize": 100, | ||
"clusterCutOff": 5, | ||
"scoreWeight": 50 | ||
}, | ||
"mixedSites": { | ||
"enabled": true, | ||
"mixedSitesThreshold": 4 | ||
}, | ||
"frameShifts": { | ||
"enabled": true | ||
}, | ||
"stopCodons": { | ||
"enabled": true, | ||
"ignoredStopCodons": [] | ||
} | ||
} |
23 changes: 23 additions & 0 deletions
23
...ets/flu_h3n2_ha/references/EPI1857216/versions/2023-11-18T12:00:00Z/files/reference.fasta
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,23 @@ | ||
>EPI_ISL_1563628 | A/Darwin/6/2021 | A / H3N2 | | 2021-03-16 | ||
atgaagactatcattgctttgagcaacattctatgtcttgttttcgctcaaaaaatacctggaaatgacaatagcacggc | ||
aacgctgtgccttgggcaccatgcagtaccaaacggaacgatagtgaaaacaatcacaaatgaccgaattgaagttacta | ||
atgctactgagttggttcagaattcatcaataggtgaaatatgcggcagtcctcatcagatccttgatggagggaactgc | ||
acactaatagatgctctattgggggaccctcagtgtgacggctttcaaaataaggaatgggacctttttgttgaaagaag | ||
cagagccaacagcaactgttacccttatgatgtgccggattatgcctcccttaggtcactagttgcctcatccggcacac | ||
tggagtttaaaaatgaaagcttcaattggactggagtcaaacaaaacggaacaagttctgcgtgcataaggggatctagt | ||
agtagtttttttagtagattaaattggttgaccagcttaaacaacatatatccagcacagaacgtgactatgccaaacaa | ||
ggaacaatttgacaaattgtacatttggggggttcaccacccggatacggacaagaaccaaatctccctgtttgctcaat | ||
catcaggaagaatcacagtatctaccaaaagaagccaacaagctgtaatcccaaatatcggatctagacccagaataagg | ||
gatatccctagcagaataagcatctattggacaatagtaaaaccgggagacatacttttgattaacagcacagggaatct | ||
aattgctcctaggggttacttcaaaatacgaagtgggaaaagctcaataatgagatcagatgcacccattggcaaatgta | ||
agtctgaatgcatcactccaaatggaagcattcccaatgacaaaccgttccaaaatgtaaacaggatcacatacggggcc | ||
tgtcccagatatgttaagcaaagcaccctgaaattggcaacaggaatgcgaaatgtaccagagaaacaaaccagaggcat | ||
atttggcgcaatagcgggtttcatagaaaatggatgggagggaatggtggatggttggtacggtttcaggcatcaaaatt | ||
ctgagggaagaggacaagcagcagatctcaaaagcactcaagcagcaatcgatcaaatcaatgggaagctgaatcgattg | ||
atcggaaaaaccaacgagaaattccatcagattgaaaaagaattctcagaagtagaaggaagagttcaagaccttgagaa | ||
atatgttgaggacactaaaatagatctctggtcatacaacgcggagcttcttgttgccctggagaaccaacatacgattg | ||
acctaactgactcagaaatgaacaaactgtttgaaaaaacaaagaagcaactgagggaaaatgctgaggatatgggaaat | ||
ggttgtttcaaaatataccacaaatgtgacaatgcctgcataggatcaataagaaatgaaacttatgaccacaatgtgta | ||
cagggatgaagcattaaacaaccggttccagatcaagggagttgagctgaagtcagggtacaaagattggatcctatgga | ||
tttcctttgccatgtcatgttttttgctttgtattgctttgttggggttcatcatgtgggcctgccaaaagggcaacatt | ||
agatgcaacatttgcatttgagtgcattaattaaaaac |
1,320 changes: 1,320 additions & 0 deletions
1,320
...ets/flu_h3n2_ha/references/EPI1857216/versions/2023-11-18T12:00:00Z/files/sequences.fasta
Large diffs are not rendered by default.
Oops, something went wrong.
25 changes: 25 additions & 0 deletions
25
data/datasets/flu_h3n2_ha/references/EPI1857216/versions/2023-11-18T12:00:00Z/files/tag.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,25 @@ | ||
{ | ||
"tag": "2023-11-18T12:00:00Z", | ||
"comment": "Addition of experimental lineages", | ||
"compatibility": { | ||
"nextcladeCli": { | ||
"min": "1.3.0", | ||
"max": null | ||
}, | ||
"nextcladeWeb": { | ||
"min": "1.6.0", | ||
"max": null | ||
} | ||
}, | ||
"enabled": true, | ||
"files": { | ||
"geneMap": "genemap.gff", | ||
"primers": "primers.csv", | ||
"qc": "qc.json", | ||
"reference": "reference.fasta", | ||
"sequences": "sequences.fasta", | ||
"tree": "tree.json", | ||
"virusPropertiesJson": "virus_properties.json" | ||
}, | ||
"metadata": {} | ||
} |
1 change: 1 addition & 0 deletions
1
.../datasets/flu_h3n2_ha/references/EPI1857216/versions/2023-11-18T12:00:00Z/files/tree.json
Large diffs are not rendered by default.
Oops, something went wrong.
56 changes: 56 additions & 0 deletions
56
...u_h3n2_ha/references/EPI1857216/versions/2023-11-18T12:00:00Z/files/virus_properties.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,56 @@ | ||
{ | ||
"schemaVersion": "1.10.0", | ||
"nucMutLabelMap": {}, | ||
"nucMutLabelMapReverse": {}, | ||
"phenotypeData":[ | ||
{ | ||
"name": "RBD", | ||
"nameFriendly": "RBD mutations", | ||
"description": "This column displays the number of differences between the sequence and the reference at positions identified by Koel et al. (145, 155, 156, 158, 159, 189, and 193 in HA1)", | ||
"gene": "HA1", | ||
"aaRange": { | ||
"begin": 100, | ||
"end": 200 | ||
}, | ||
"ignore": { | ||
"clades": ["outgroup"] | ||
}, | ||
"data": [ | ||
{ | ||
"name": "differences", | ||
"weight": 1, | ||
"locations": { | ||
"145": {"default":1}, | ||
"155": {"default":1}, | ||
"156": {"default":1}, | ||
"158": {"default":1}, | ||
"159": {"default":1}, | ||
"189": {"default":1}, | ||
"193": {"default":1} | ||
} | ||
} | ||
] | ||
} | ||
], | ||
"aaMotifs": [ | ||
{ | ||
"name": "glycosylation", | ||
"nameShort": "Glyc.", | ||
"nameFriendly": "Glycosylation", | ||
"description": "N-linked glycosylation motifs (N-X-S/T with X any amino acid other than P)", | ||
"includeGenes": [ | ||
{ | ||
"gene":"HA1", | ||
"ranges":[] | ||
}, | ||
{ | ||
"gene":"HA2", | ||
"ranges":[{"begin":0, "end":186}] | ||
} | ||
], | ||
"motifs": [ | ||
"N[^P][ST]" | ||
] | ||
} | ||
] | ||
} |