Make tree for 450bp of the N gene ("N450") #20
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,45 @@ | ||
| { | ||
| "title": "Real-time tracking of measles virus evolution", | ||
| "maintainers": [ | ||
| {"name": "Kim Andrews", "url": "https://bedford.io/team/kim-andrews/"}, | ||
| {"name": "the Nextstrain team", "url": "https://nextstrain.org/team"} | ||
| ], | ||
| "build_url": "https://github.com/nextstrain/measles", | ||
| "colorings": [ | ||
| { | ||
| "key": "gt", | ||
| "title": "Genotype", | ||
| "type": "categorical" | ||
| }, | ||
| { | ||
| "key": "num_date", | ||
| "title": "Date", | ||
| "type": "continuous" | ||
| }, | ||
| { | ||
| "key": "country", | ||
| "title": "Country", | ||
| "type": "categorical" | ||
| }, | ||
| { | ||
| "key": "region", | ||
| "title": "Region", | ||
| "type": "categorical" | ||
| } | ||
| ], | ||
| "geo_resolutions": [ | ||
| "country", | ||
| "region" | ||
| ], | ||
| "display_defaults": { | ||
| "map_triplicate": true | ||
| }, | ||
| "filters": [ | ||
| "country", | ||
| "region", | ||
| "author" | ||
| ], | ||
| "metadata_columns": [ | ||
| "author" | ||
| ] | ||
| } |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
|
|
@@ -4,23 +4,3 @@ region Africa #8ABB6A | |
| region Europe #BEBB48 | ||
| region South America #E29E39 | ||
| region North America #E2562B | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,8 @@ | ||
| >lcl|NC_001498.1_cds_NP_056918.1_1 [gene=N] [locus_tag=MeVgp1] [db_xref=GeneID:1489804] [protein=nucleocapsid protein] [protein_id=NP_056918.1] [location=1233..1682] [gbkey=CDS] | ||
| GTCAGTTCCACATTGGCATCCGAACTCGGTATCACTGCCGAGGATGCAAGGCTTGTTTCAGAGAT | ||
| TGCAATGCATACTACTGAGGACAGGATCAGTAGAGCGGTCGGACCCAGACAAGCCCAAGTGTCATTTCTA | ||
| CACGGTGATCAAAGTGAGAATGAGCTACCAGGATTGGGGGGCAAGGAAGATAGGAGGGTCAAACAGGGTC | ||
| GGGGAGAAGCCAGGGAGAGCTACAGAGAAACCGGGTCCAGCAGAGCAAGTGATGCGAGAGCTGCCCATCC | ||
| TCCAACCAGCATGCCCCTAGACATTGACACTGCATCGGAGTCAGGCCAAGATCCGCAGGACAGTCGAAGG | ||
| TCAGCTGACGCCCTGCTCAGGCTGCAAGCCATGGCAGGAATCTTGGAAGAACAAGGCTCAGACACGGACA | ||
| CCCCTAGGGTATACAATGACAGAGATCTTCTAGAC |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,69 @@ | ||
| LOCUS NC_001498 450 bp cRNA linear VRL 13-AUG-2018 | ||
| DEFINITION Measles virus, complete genome. | ||
| ACCESSION NC_001498 REGION: 1233..1682 | ||
| VERSION NC_001498.1 | ||
| DBLINK Project: 15025 | ||
| BioProject: PRJNA485481 | ||
| KEYWORDS RefSeq. | ||
| SOURCE Measles morbillivirus | ||
| ORGANISM Measles morbillivirus | ||
| Viruses; Riboviria; Orthornavirae; Negarnaviricota; | ||
| Haploviricotina; Monjiviricetes; Mononegavirales; Paramyxoviridae; | ||
| Orthoparamyxovirinae; Morbillivirus; Morbillivirus hominis. | ||
| REFERENCE 1 (sites) | ||
| AUTHORS Rima,B.K. and Duprex,W.P. | ||
| TITLE The measles virus replication cycle | ||
| JOURNAL Curr. Top. Microbiol. Immunol. 329, 77-102 (2009) | ||
| PUBMED 19198563 | ||
| REFERENCE 2 | ||
| AUTHORS Takeuchi,K., Miyajima,N., Kobune,F. and Tashiro,M. | ||
| TITLE Comparative nucleotide sequence analyses of the entire genomes of | ||
| B95a cell-isolated and vero cell-isolated measles viruses from the | ||
| same patient | ||
| JOURNAL Virus Genes 20 (3), 253-257 (2000) | ||
| PUBMED 10949953 | ||
| REFERENCE 3 (bases 1 to 450) | ||
| CONSRTM NCBI Genome Project | ||
| TITLE Direct Submission | ||
| JOURNAL Submitted (01-AUG-2000) National Center for Biotechnology | ||
| Information, NIH, Bethesda, MD 20894, USA | ||
| REFERENCE 4 (bases 1 to 450) | ||
| AUTHORS Takeuchi,K., Tanabayashi,K. and Tashiro,M. | ||
| TITLE Direct Submission | ||
| JOURNAL Submitted (10-JUL-1998) Kaoru Takeuchi, National Institute of | ||
| Infectious Diseases, Viral Disease and Vaccine Contorol; 4-7-1 | ||
| Gakuen, Musashi-murayama, Tokyo 208-0011, Japan | ||
| (E-mail:[email protected], Tel:81-42-561-0771(ex.530), | ||
| Fax:81-42-567-5631) | ||
| COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The | ||
| reference sequence was derived from AB016162. | ||
| Sequence updated (21-Jul-1998) | ||
| Sequence updated (11-Dec-1998). | ||
| COMPLETENESS: full length. | ||
| FEATURES Location/Qualifiers | ||
| source 1..450 | ||
| /organism="Measles morbillivirus" | ||
| /mol_type="viral cRNA" | ||
| /strain="Ichinose-B95a" | ||
| /db_xref="taxon:11234" | ||
| CDS <1..>450 | ||
jameshadfield marked this conversation as resolved.
Show resolved
Hide resolved
|
||
| /gene="N" | ||
| /codon_start=1 | ||
| /product="nucleocapsid protein" | ||
| /protein_id="NP_056918.1" | ||
| /db_xref="GeneID:1489804" | ||
| /translation="VSSTLASELGITAEDAR | ||
| LVSEIAMHTTEDRISRAVGPRQAQVSFLHGDQSENELPGLGGKEDRRVKQGRGEARES | ||
| YRETGSSRASDARAAHPPTSMPLDIDTASESGQDPQDSRRSADALLRLQAMAGILEEQ | ||
| GSDTDTPRVYNDRDLLD" | ||
| ORIGIN | ||
| 1 gtcagttcca cattggcatc cgaactcggt atcactgccg aggatgcaag gcttgtttca | ||
| 61 gagattgcaa tgcatactac tgaggacagg atcagtagag cggtcggacc cagacaagcc | ||
| 121 caagtgtcat ttctacacgg tgatcaaagt gagaatgagc taccaggatt ggggggcaag | ||
| 181 gaagatagga gggtcaaaca gggtcgggga gaagccaggg agagctacag agaaaccggg | ||
| 241 tccagcagag caagtgatgc gagagctgcc catcctccaa ccagcatgcc cctagacatt | ||
| 301 gacactgcat cggagtcagg ccaagatccg caggacagtc gaaggtcagc tgacgccctg | ||
| 361 ctcaggctgc aagccatggc aggaatcttg gaagaacaag gctcagacac ggacacccct | ||
| 421 agggtataca atgacagaga tcttctagac | ||
| // | ||
|
|
||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
|
|
@@ -7,9 +7,9 @@ See Augur's usage docs for these commands for more details. | |
| rule tree: | ||
| """Building tree""" | ||
| input: | ||
| alignment = "results/{gene}/aligned.fasta" | ||
| output: | ||
| tree = "results/{gene}/tree_raw.nwk" | ||
| shell: | ||
| """ | ||
| augur tree \ | ||
|
|
@@ -26,12 +26,12 @@ rule refine: | |
| - filter tips more than {params.clock_filter_iqd} IQDs from clock expectation | ||
| """ | ||
| input: | ||
| tree = "results/{gene}/tree_raw.nwk", | ||
| alignment = "results/{gene}/aligned.fasta", | ||
| metadata = "data/metadata.tsv" | ||
| output: | ||
|
There was a problem hiding this comment. The temporal signal is much better in this build (and the build Trevor showed me) than the one we looked at mid-week - do you know what changed? This gives me more confidence that the (temporal) rooting is working ok for the N450 build - it's broadly similar to the genome build - and so there's no longer a need to start in "unrooted" view if you'd prefer to go back to the more typical rectangular view. 
There was a problem hiding this comment. The lower temporal signal for the tree I showed you last week seems to be related to the subsampling method I had used. Here is the subsampling method I used for that tree:
And here is the clock view for a tree I generated today using that subsampling method: 
There was a problem hiding this comment. Changed default display back to rooted time-tree in 862dbaf |
||
| tree = "results/{gene}/tree.nwk", | ||
| node_data = "results/{gene}/branch_lengths.json" | ||
| params: | ||
|
There was a problem hiding this comment. The following deprecation notice is present when running refine: DEPRECATION WARNING. TreeTime.resolve_polytomies: You are resolving
polytomies using the old 'greedy' mode. This is not well suited for large
polytomies. Stochastic resolution will become the default in future
versions. To switch now, rerun with the flag `--stochastic-resolve`. To
keep using the greedy method in the future, run with `--greedy-resolve`Especially for the N450 build where we will have large polytomies we should use |
||
| coalescent = config["refine"]["coalescent"], | ||
| date_inference = config["refine"]["date_inference"], | ||
|
|
@@ -50,6 +50,7 @@ rule refine: | |
| --coalescent {params.coalescent} \ | ||
| --date-confidence \ | ||
| --date-inference {params.date_inference} \ | ||
| --clock-filter-iqd {params.clock_filter_iqd} \ | ||
| --stochastic-resolve | ||
| """ | ||
|
|
||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,58 @@ | ||
| """ | ||
| This part of the workflow prepares sequences for constructing the phylogenetic tree for 450bp of the N gene. | ||
|
|
||
| See Augur's usage docs for these commands for more details. | ||
| """ | ||
|
|
||
| rule align_and_extract_N450: | ||
| input: | ||
| sequences = "data/sequences.fasta", | ||
| reference = config["files"]["reference_N450_fasta"] | ||
| output: | ||
| sequences = "results/N450/sequences.fasta" | ||
| params: | ||
| min_length = config['filter_N450']['min_length'] | ||
| shell: | ||
| """ | ||
| nextclade run \ | ||
| -j 1 \ | ||
| --input-ref {input.reference} \ | ||
| --output-fasta {output.sequences} \ | ||
| --min-seed-cover 0.01 \ | ||
| --min-length {params.min_length} \ | ||
| --silent \ | ||
| {input.sequences} | ||
| """ | ||
| rule filter_N450: | ||
| """ | ||
| Filtering to | ||
| - {params.sequences_per_group} sequence(s) per {params.group_by!s} | ||
| - excluding strains in {input.exclude} | ||
| - minimum genome length of {params.min_length} | ||
| - excluding strains with missing region, country or date metadata | ||
| """ | ||
| input: | ||
| sequences = "results/N450/sequences.fasta", | ||
| metadata = "data/metadata.tsv", | ||
| exclude = config["files"]["exclude"] | ||
| output: | ||
| sequences = "results/N450/aligned.fasta" | ||
| params: | ||
| group_by = config['filter_N450']['group_by'], | ||
| subsample_max_sequences = config["filter_N450"]["subsample_max_sequences"], | ||
| min_date = config["filter_N450"]["min_date"], | ||
| min_length = config['filter_N450']['min_length'], | ||
| strain_id = config["strain_id_field"] | ||
| shell: | ||
| """ | ||
| augur filter \ | ||
| --sequences {input.sequences} \ | ||
| --metadata {input.metadata} \ | ||
| --metadata-id-columns {params.strain_id} \ | ||
| --exclude {input.exclude} \ | ||
| --output {output.sequences} \ | ||
| --group-by {params.group_by} \ | ||
| --subsample-max-sequences {params.subsample_max_sequences} \ | ||
| --min-date {params.min_date} \ | ||
| --min-length {params.min_length} | ||
| """ |
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
[minor, not blocking]
@joverlee521 do you have a canonical way we should structure build-specific rule parameters (e.g.
filtervsfilter_N450) when we want to use a single config file for both/all builds?There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
I do not (yet?), the pathogen-repo-guide has been based on one build per config file.
Existing workflows use three different patterns
This would look like:
This would look like:
This would look like:
[1] is the most flexible, allowing each build to define its own parameters. This makes it very easy to scan the config file for one build's parameters in a single place. However, since each param has to be defined per build, this can result in very long config files, which is why seasonal-flu has complex array-builds configs to programmatically create the configs during the workflow.
[2] is also pretty flexible, where each build can configure each parameter per rule grouping. There's less repetition of parameters so config files won't be as long, but a single build's config is spread throughout the rules groupings. It is also not very clear which rule configs can be configured per build and which rule configs are shared among builds.
[3] is the least flexible, as it only allows each build to change specific configs. This can also be confusing why some configs are nested while others are not.