Lab: DNA I Read QC and trimming

1. Finding and assigning fastq data files

The S. invicta RAD data we are using for the labs comes from this project. We have already downloaded all the reads, which can be found here: /pickett_shared/teaching/EPP622_Fall2022/raw_data/solenopsis_invicta. Please view the below table, as every student has been assigned a read for the duration of the DNA I unit.

Student	Read Accession	Total # Reads	Location
Jamie Alumbaugh	SRR6922148	1281077	Oglethorpe Co, GA
Cassidy Catrett	SRR6922294	1405770	Oglethorpe Co, GA
Jenna Demeter	SRR6922306	1541579	Oglethorpe Co, GA
Presley Dowker	SRR6922308	2987905	Oglethorpe Co, GA
Nick Gill	SRR6922451	1731620	Oglethorpe Co, GA
Axel Gonzalez Murillo	SRR6922454	2897067	Oglethorpe Co, GA
Rebecca Butler	SRR6922449	3649330	Oglethorpe Co, GA
Eunice Omondi	SRR6922311	258861	Oglethorpe Co, GA
Madison Henniger	SRR6922354	1344896	Pascagoula, MS
Katelin Hubbard	SRR6922399	1091567	Pascagoula, MS
Harleen Kaur	SRR6922194	1100979	Alejandra, Argentina
Peitong Li	SRR6922233	1216598	Alejandra, Argentina
Leif Majeres	SRR6922241	1148981	Alejandra, Argentina
Dillon McCallum	SRR6922315	1017635	Alejandra, Argentina
Ruwaa Mohamed	SRR6922318	1592618	Alejandra, Argentina
Shade Niece	SRR6922319	2199106	Alejandra, Argentina
Beatrice Caiado	SRR6922321	1696637	Alejandra, Argentina
Rachel Robrecht	SRR6922446	991054	Alejandra, Argentina
Raj Roy	SRR6922447	1957684	Alejandra, Argentina
Rebecca Smith	SRR6922448	1053520	Alejandra, Argentina
Jennifer Chandler	SRR6922316	913465	Alejandra, Argentina
Garrett Franklin	SRR6922314	533098	Alejandra, Argentina
Triston Walsh	SRR6922320	683277	Alejandra, Argentina
Zane Smith	SRR6922276	1111463	El Recreo, Argentina
Peter Tandy	SRR6922278	1223105	El Recreo, Argentina
Bryce Trull	SRR6922291	1154914	El Recreo, Argentina
Jackson Turner	SRR6922309	1771519	El Recreo, Argentina
Instructor	SRR6922470	1548618	El Recreo, Argentina

2. Setting up a personal directory

Go to the analysis directory within the EPP 622 course directory:

/pickett_shared/teaching/EPP622_Fall2022/analysis

...and make a personal analysis folder. For example:

mkdir <your user id goes here>
cd <your user id goes here>

3. Running fastqc

Now, let's make a directory where we will run`fastqc:

mkdir 1_fastqc
cd 1_fastqc

We can create a soft link (symbolic link) to the raw data

ln -s ../../../raw_data/solenopsis_invicta/<your subset>.fastq .

Let's load fastqc:

spack load fastqc

Let's run the program now. Since, we all are sharing the same computing resource, we will run fastqc on just one forward read fastq file -

fastqc <your subset>

This program outputs results in`.zip and .html formats. We can't inspect them on sphinx, so we'll need to copy them to our own devices.

scp '<your_username>@sphinx.ag.utk.edu:/pickett_shared/teaching/EPP622_Fall2022/analysis/<your_username>/1_fastqc/*html' ./

4. Running Skewer

skewer github

Skewer is a fast and accurate adapter trimmer for next-generation sequencing paired-end reads. It has several features such as detecting and removing adapter sequences, trimming sequences based on phred quality scores etc. Now, go to your personal analyses directory and make a new directory -

cd /pickett_shared/teaching/EPP622_Fall2022/analysis/<your name>
mkdir 2_skewer
cd 2_skewer

Soft link the raw data files here, too (the space is free!)

ln -s ../../../raw_data/solenopsis_invicta/<your subset>.fastq .

Skewer is installed locally on sphinx therefore, we won't have to use Spack to load it this time.

/sphinx_local/software/skewer/skewer -t 2 -l 95 -x AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG -Q 30 <your subset> -o <outfile name>

-t stands for number of threads used by this command
-l stands for minimum length of sequence we want to keep in our analyses
-Q is the minimum mean quality score (Phred score) of the sequence (across the entire read length)

Note: Here we use Q 30 as an illustrative example because the data is already very high quality. In some instances, Q 30 may be considered on the more strict end of trimming thresholds (see Del Fabbro et al. 2013).

Say you wanted to trim all the files using a for loop. Here is an example of how to do that:

for f in *fastq
do
	BASE=$( basename $f | sed 's/_1.fastq//g')
	echo $BASE

	/sphinx_local/software/skewer/skewer \
	-t 2 -l 95 -Q 30 \
	-x AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG \
	$f -o $BASE 
done

5. Run fastqc on trimmed files

Now that we have trimmed our sequence file, let's check it's quality using fastqc. So, go back to your personal directory and make a new directory -

fastqc <your subset>-trimmed.fastq