Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Convert static str to static CStr for simpler code #91

Merged
merged 1 commit into from
Nov 23, 2024
Merged

Convert static str to static CStr for simpler code #91

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
1 commit
Select commit
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
4 changes: 2 additions & 2 deletions Cargo.toml
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -28,7 +28,7 @@ exclude = ["minimappers2", "fakeminimap2", "minimap2-sys"]

[dependencies]
libc = "0.2"
simdutf8 = { version = "0.1", optional = true }
# simdutf8 = { version = "0.1", optional = true }
needletail = { version = "0.6", optional = true, default-features = false}

# Dep for development
Expand All @@ -53,7 +53,7 @@ default = ["map-file"]
sse2only = ["minimap2-sys/sse2only"]
htslib = ['rust-htslib']
simde = ["minimap2-sys/simde"]
map-file = ["needletail", "simdutf8"]
map-file = ["needletail"] #, "simdutf8"]
zlib-ng = ["minimap2-sys/zlib-ng"]
curl = ["rust-htslib/curl"]
static = ["minimap2-sys/static", "rust-htslib/static"]
Expand Down
135 changes: 56 additions & 79 deletions src/lib.rs
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -44,7 +44,6 @@
//! assert_eq!(hits.unwrap().len(), 1);
//! ```

use std::borrow::Cow;
use std::cell::RefCell;

use std::ffi::{CStr, CString};
Expand All @@ -58,9 +57,6 @@ use std::os::unix::ffi::OsStrExt;
use libc::c_void;
use minimap2_sys::*;

#[cfg(feature = "map-file")]
use simdutf8::basic::from_utf8;

#[cfg(feature = "map-file")]
use needletail::parse_fastx_file;

Expand All @@ -75,25 +71,25 @@ pub type IdxOpt = mm_idxopt_t;

// TODO: Probably a better way to handle this...
/// C string constants for passing to minimap2
static LRHQAE: &str = "lr:hqae\0";
static LRHQ: &str = "lr:hq\0";
static SPLICE: &str = "splice\0";
static SPLICEHQ: &str = "splice:hq\0";
static ASM: &str = "asm\0";
static ASM5: &str = "asm5\0";
static ASM10: &str = "asm10\0";
static ASM20: &str = "asm20\0";
static SR: &str = "sr\0";
static MAP_PB: &str = "map-pb\0";
static MAP_HIFI: &str = "map-hifi\0";
static MAP_ONT: &str = "map-ont\0";
static AVA_PB: &str = "ava-pb\0";
static AVA_ONT: &str = "ava-ont\0";
static LRHQAE: &CStr = c"lr:hqae";
static LRHQ: &CStr = c"lr:hq";
static SPLICE: &CStr = c"splice";
static SPLICEHQ: &CStr = c"splice:hq";
static ASM: &CStr = c"asm";
static ASM5: &CStr = c"asm5";
static ASM10: &CStr = c"asm10";
static ASM20: &CStr = c"asm20";
static SR: &CStr = c"sr";
static MAP_PB: &CStr = c"map-pb";
static MAP_HIFI: &CStr = c"map-hifi";
static MAP_ONT: &CStr = c"map-ont";
static AVA_PB: &CStr = c"ava-pb";
static AVA_ONT: &CStr = c"ava-ont";

// These aren't listed in the command anymore, but are still available
static SHORT: &str = "short\0";
static MAP10K: &str = "map10k\0";
static CDNA: &str = "cdna\0";
static SHORT: &CStr = c"short";
static MAP10K: &CStr = c"map10k";
static CDNA: &CStr = c"cdna";

/// Strand enum
#[derive(Debug, PartialEq, Eq, Copy, Clone, Default)]
Expand Down Expand Up @@ -135,51 +131,26 @@ pub enum Preset {
}

// Convert to c string for input into minimap2
impl From<Preset> for *const i8 {
fn from(preset: Preset) -> Self {
match preset {
Preset::LrHqae => LRHQAE.as_bytes().as_ptr() as *const i8,
Preset::LrHq => LRHQ.as_bytes().as_ptr() as *const i8,
Preset::Splice => SPLICE.as_bytes().as_ptr() as *const i8,
Preset::SpliceHq => SPLICEHQ.as_bytes().as_ptr() as *const i8,
Preset::Asm => ASM.as_bytes().as_ptr() as *const i8,
Preset::Asm5 => ASM5.as_bytes().as_ptr() as *const i8,
Preset::Asm10 => ASM10.as_bytes().as_ptr() as *const i8,
Preset::Asm20 => ASM20.as_bytes().as_ptr() as *const i8,
Preset::Sr => SR.as_bytes().as_ptr() as *const i8,
Preset::MapPb => MAP_PB.as_bytes().as_ptr() as *const i8,
Preset::MapHifi => MAP_HIFI.as_bytes().as_ptr() as *const i8,
Preset::MapOnt => MAP_ONT.as_bytes().as_ptr() as *const i8,
Preset::AvaPb => AVA_PB.as_bytes().as_ptr() as *const i8,
Preset::AvaOnt => AVA_ONT.as_bytes().as_ptr() as *const i8,
Preset::Short => SHORT.as_bytes().as_ptr() as *const i8,
Preset::Map10k => MAP10K.as_bytes().as_ptr() as *const i8,
Preset::Cdna => CDNA.as_bytes().as_ptr() as *const i8,
}
}
}

// Convert to c string for input into minimap2
impl From<Preset> for *const u8 {
impl From<Preset> for *const libc::c_char {
fn from(preset: Preset) -> Self {
match preset {
Preset::LrHqae => LRHQAE.as_bytes().as_ptr(),
Preset::LrHq => LRHQ.as_bytes().as_ptr(),
Preset::Splice => SPLICE.as_bytes().as_ptr(),
Preset::SpliceHq => SPLICEHQ.as_bytes().as_ptr(),
Preset::Asm => ASM.as_bytes().as_ptr(),
Preset::Asm5 => ASM5.as_bytes().as_ptr(),
Preset::Asm10 => ASM10.as_bytes().as_ptr(),
Preset::Asm20 => ASM20.as_bytes().as_ptr(),
Preset::Sr => SR.as_bytes().as_ptr(),
Preset::MapPb => MAP_PB.as_bytes().as_ptr(),
Preset::MapHifi => MAP_HIFI.as_bytes().as_ptr(),
Preset::MapOnt => MAP_ONT.as_bytes().as_ptr(),
Preset::AvaPb => AVA_PB.as_bytes().as_ptr(),
Preset::AvaOnt => AVA_ONT.as_bytes().as_ptr(),
Preset::Short => SHORT.as_bytes().as_ptr(),
Preset::Map10k => MAP10K.as_bytes().as_ptr(),
Preset::Cdna => CDNA.as_bytes().as_ptr(),
Preset::LrHqae => LRHQAE.as_ptr(),
Preset::LrHq => LRHQ.as_ptr(),
Preset::Splice => SPLICE.as_ptr(),
Preset::SpliceHq => SPLICEHQ.as_ptr(),
Preset::Asm => ASM.as_ptr(),
Preset::Asm5 => ASM5.as_ptr(),
Preset::Asm10 => ASM10.as_ptr(),
Preset::Asm20 => ASM20.as_ptr(),
Preset::Sr => SR.as_ptr(),
Preset::MapPb => MAP_PB.as_ptr(),
Preset::MapHifi => MAP_HIFI.as_ptr(),
Preset::MapOnt => MAP_ONT.as_ptr(),
Preset::AvaPb => AVA_PB.as_ptr(),
Preset::AvaOnt => AVA_ONT.as_ptr(),
Preset::Short => SHORT.as_ptr(),
Preset::Map10k => MAP10K.as_ptr(),
Preset::Cdna => CDNA.as_ptr(),
}
}
}
Expand Down Expand Up @@ -611,6 +582,7 @@ impl Aligner {
}

// Check options
/// Check if the options are valid - Maps to mm_check_opt in minimap2
pub fn check_opts(&self) -> Result<(), &'static str> {
let result = unsafe { mm_check_opt(&self.idxopt, &self.mapopt) };

Expand Down Expand Up @@ -853,7 +825,7 @@ impl Aligner {
return Err("Sequence is empty");
}

let mut qname_cstring = None;
let qname_cstring;

let query_name_cstr: Option<&CStr> = match query_name.as_ref() {
None => None,
Expand Down Expand Up @@ -1249,7 +1221,7 @@ mod tests {
aligner
});

let aligner = jh.join().unwrap();
let _aligner = jh.join().unwrap();
}

#[test]
Expand Down Expand Up @@ -1285,6 +1257,8 @@ mod tests {
let mappings = aligner_handle.map("ACGGTAGAGAGGAAGAAGAAGGAATAGCGGACTTGTGTATTTTATCGTCATTCGTGGTTATCATATAGTTTATTGATTTGAAGACTACGTAAGTAATTTGAGGACTGATTAAAATTTTCTTTTTTAGCTTAGAGTCAATTAAAGAGGGCAAAATTTTCTCAAAAGACCATGGTGCATATGACGATAGCTTTAGTAGTATGGATTGGGCTCTTCTTTCATGGATGTTATTCAGAAGGAGTGATATATCGAGGTGTTTGAAACACCAGCGACACCAGAAGGCTGTGGATGTTAAATCGTAGAACCTATAGACGAGTTCTAAAATATACTTTGGGGTTTTCAGCGATGCAAAA".as_bytes(), false, false, None, None, Some("Sample Query")).unwrap();
assert!(mappings[0].query_len == Some(NonZeroI32::new(350).unwrap()));
});

jh0.join().unwrap();

let aligner_handle = Arc::clone(&aligner);
let jh1 = thread::spawn(move || {
Expand All @@ -1293,6 +1267,9 @@ mod tests {
let mappings = aligner_handle.map("ACGGTAGAGAGGAAGAAGAAGGAATAGCGGACTTGTGTATTTTATCGTCATTCGTGGTTATCATATAGTTTATTGATTTGAAGACTACGTAAGTAATTTGAGGACTGATTAAAATTTTCTTTTTTAGCTTAGAGTCAATTAAAGAGGGCAAAATTTTCTCAAAAGACCATGGTGCATATGACGATAGCTTTAGTAGTATGGATTGGGCTCTTCTTTCATGGATGTTATTCAGAAGGAGTGATATATCGAGGTGTTTGAAACACCAGCGACACCAGAAGGCTGTGGATGTTAAATCGTAGAACCTATAGACGAGTTCTAAAATATACTTTGGGGTTTTCAGCGATGCAAAA".as_bytes(), false, false, None, None, Some("Sample Query")).unwrap();
assert!(mappings[0].query_len == Some(NonZeroI32::new(350).unwrap()));
});

jh1.join().unwrap();

}

#[test]
Expand Down Expand Up @@ -1325,7 +1302,7 @@ mod tests {
"ACGGTAGAGAGGAAGAAGAAGGAATAGCGGACTTGTGTATTTTATCGTCATTCGTGGTTATCATATAGTTTATTGATTTGAAGACTACGTAAGTAATTTGAGGACTGATTAAAATTTTCTTTTTTAGCTTAGAGTCAATTAAAGAGGGCAAAATTTTCTCAAAAGACCATGGTGCATATGACGATAGCTTTAGTAGTATGGATTGGGCTCTTCTTTCATGGATGTTATTCAGAAGGAGTGATATATCGAG",
];

let results = sequences
let _results = sequences
.par_iter()
.map(|seq| {
aligner
Expand All @@ -1352,13 +1329,13 @@ mod tests {

#[test]
fn idxopt() {
let x: IdxOpt = Default::default();
let _x: IdxOpt = Default::default();
}

#[test]
fn mapopt() {
let x: mm_mapopt_t = Default::default();
let y: MapOpt = Default::default();
let _x: mm_mapopt_t = Default::default();
let _y: MapOpt = Default::default();
}

#[test]
Expand All @@ -1371,7 +1348,7 @@ mod tests {
let idx = None;
let idx_reader = None;

let aligner = Aligner {
let _aligner = Aligner {
idxopt,
mapopt,
threads,
Expand All @@ -1383,17 +1360,17 @@ mod tests {

#[test]
fn aligner_builder() {
let result = Aligner::builder();
let _result = Aligner::builder();
}

#[test]
fn aligner_builder_preset() {
let result = Aligner::builder().preset(Preset::LrHq);
let _result = Aligner::builder().preset(Preset::LrHq);
}

#[test]
fn aligner_builder_preset_with_threads() {
let result = Aligner::builder()
let _result = Aligner::builder()
.preset(Preset::LrHq)
.with_index_threads(1);
}
Expand All @@ -1412,15 +1389,15 @@ mod tests {

#[test]
fn create_index() {
let mut aligner = Aligner::builder()
let aligner = Aligner::builder()
.preset(Preset::MapOnt)
.with_index_threads(1);

println!("{}", aligner.idxopt.w);

assert!(aligner.idxopt.w == 10);

aligner = aligner
aligner
.with_index("test_data/test_data.fasta", Some("test.mmi"))
.unwrap();
}
Expand Down Expand Up @@ -1459,7 +1436,7 @@ mod tests {
// Assert the Display impl for strand works
println!("{}", mappings[0].strand);

let mut aligner = aligner.with_cigar();
let aligner = aligner.with_cigar();

aligner
.map(
Expand Down Expand Up @@ -1626,7 +1603,7 @@ mod tests {
true, true, None, None, Some("Sample Query")).unwrap();
assert_eq!(mappings.len(), 1);

let observed = mappings.pop().unwrap();
let _observed = mappings.pop().unwrap();

assert_eq!(
align.cigar,
Expand Down Expand Up @@ -1948,7 +1925,7 @@ mod tests {
sr.mapopt.best_n = 1;
sr.idxopt.k = 7;

let aligner = Aligner {
let _aligner = Aligner {
mapopt: MapOpt {
best_n: 1,
..Aligner::builder().sr().mapopt
Expand Down
Loading