Simple tests for correct gene model and sixframe

Mostly to experiment with cypress-image-diff

packages/jbrowse-plugin-apollo/cypress/e2e/showWarnings.cy.ts

@@ -0,0 +1,56 @@
+describe('Visual', () => {
+  beforeEach(() => {
+    cy.loginAsGuest()
+  })
+  afterEach(() => {
+    cy.deleteAssemblies()
+  })
+  it('Show warnings', () => {
+    cy.addAssemblyFromGff(
+      'stopcodon.gff3',
+      'test_data/cdsChecks/stopcodon.gff3',
+    )
+    cy.selectAssemblyToView('stopcodon.gff3')
+    cy.searchFeatures('gene07', 1)
+
+    // Here it would be nice to check that there are no ErrorIcons yet.
+    // For this we need to make sure that the gene model is actually on the canvas,
+    // which is not obvious how to do.
+
+    cy.get('button[data-testid="track_menu_icon"]').click()
+    cy.contains('Appearance').trigger('mouseover')
+    cy.contains('Show both graphical and table display').click()
+    cy.contains('cds07').rightclick()
+    cy.contains('Edit feature details').click()
+    cy.contains('Basic information')
+      .parent()
+      .within(() => {
+        cy.get('input[value="16"]').type('{selectall}{backspace}4{enter}')
+        cy.get('input[value="27"]').type('{selectall}{backspace}24{enter}')
+      })
+    cy.get('button[data-testid="zoom_out"]').click()
+
+    // FIXME: There should be 2 ErrorIcons not 3
+    cy.get('[data-testid="ErrorIcon"]', { timeout: 5000 }).should(
+      'have.length',
+      3,
+    )
+    cy.get('[data-testid="ErrorIcon"]', { timeout: 5000 })
+      .last()
+      .trigger('mouseover')
+    cy.contains(/(internal stop codon)|(missing stop codon)/)
+
+    // Fix the missing stop codon. Internal stop still expected
+    cy.contains('Basic information')
+      .parent()
+      .within(() => {
+        cy.get('input[value="24"]').type('{selectall}{backspace}27{enter}')
+      })
+    cy.get('button[data-testid="zoom_out"]').click()
+    cy.reload()
+    cy.get('[data-testid="ErrorIcon"]', { timeout: 5000 }).should(
+      'have.length',
+      1,
+    )
+  })
+})

packages/jbrowse-plugin-apollo/cypress/e2e/simpleVisual.cy.ts

@@ -0,0 +1,23 @@
+describe('Simple tests for visuals', () => {
+  beforeEach(() => {
+    cy.loginAsGuest()
+  })
+  afterEach(() => {
+    cy.deleteAssemblies()
+  })
+  it('Shows correct gene model', () => {
+    cy.addAssemblyFromGff(
+      'stopcodon.gff3',
+      'test_data/cdsChecks/stopcodon.gff3',
+    )
+    cy.selectAssemblyToView('stopcodon.gff3')
+    cy.searchFeatures('gene08', 1)
+    cy.wait(5000) // Wait for the gene model to render. It would be better to ensure some element of the canvas is actually there
+
+    cy.get('canvas[data-testid="overlayCanvas"]').compareSnapshot('gene-model')
+
+    cy.get('canvas[data-testid="seqTrackOverlayCanvas"]').compareSnapshot(
+      'sixframe',
+    )
+  })
+})

packages/jbrowse-plugin-apollo/cypress/tsconfig.json

@@ -4,6 +4,7 @@
     "lib": ["es5", "dom"],
     "types": ["cypress", "node"],
     "strict": true,
+    "esModuleInterop": true,
   },
   "include": ["**/*.ts", "../cypress.config.js"],
 }

packages/jbrowse-plugin-apollo/test_data/cdsChecks/stopcodon.gff3

@@ -22,6 +22,17 @@ chr4	.	CDS	1	30	.	-	0	ID=cds04.1;Parent=mrna04
 chr6	.	gene	1	30	.	+	.	ID=gene06
 chr6	.	mRNA	1	30	.	+	.	ID=mrna06;Parent=gene06
 chr6	.	CDS	1	10	.	+	0	ID=cds06.1;Parent=mrna06
+#
+chr7	.	gene	4	27	.	+	.	ID=gene07
+chr7	.	mRNA	4	27	.	+	.	ID=mrna07;Parent=gene07
+chr7	.	exon	4	27	.	+	0	ID=exon07;Parent=mrna07
+chr7	.	CDS	16	27	.	+	0	ID=cds07;Parent=mrna07
+#
+chr8	.	gene	1	32	.	+	.	ID=gene08
+chr8	.	mRNA	1	32	.	+	.	ID=mrna08;Parent=gene08
+chr8	.	exon	1	12	.	+	0	ID=exon08.1;Parent=mrna08
+chr8	.	exon	16	32	.	+	0	ID=exon08.2;Parent=mrna08
+chr8	.	CDS	4	27	.	+	0	ID=cds08;Parent=mrna08
 ##FASTA
 >chr1
 ATGGTGCCGCAAAGTACTGGTGGGGGTTAAnnnnnnnnnnnnnnnnnnnnn
@@ -35,3 +46,7 @@ TTActaCCCACCAGTACTTTGCGGtcaCATnnnnnnnnnnnnnnnnnnnnn
 ATGGTGtagCAAAGTACTGTTAGGGGTTAAnnnnnnnnnnnnnnnnnnnnn
 >chr6
 ATGGTGtagCAAAGTACTGTTAGGGGTTAAnnnnnnnnnnnnnnnnnnnnn
+>chr7
+ATGGTGtagCAAAGTATGGTTAGGtagTAAnnnnnnnnnnnnnnnnnnnnn
+>chr8
+ATGATGTATCAAAGTATGGTTAGGTAGTAACTGCTCAGCAATCTATCTTTA