forked from galaxyproject/iwc
-
Notifications
You must be signed in to change notification settings - Fork 8
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge branch 'main' into workflows/transcriptomics/rnaseq-sr
- Loading branch information
Showing
46 changed files
with
16,348 additions
and
352 deletions.
There are no files selected for viewing
8 changes: 7 additions & 1 deletion
8
workflows/data-fetching/parallel-accession-download/.dockstore.yml
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1,7 +1,13 @@ | ||
| version: 1.2 | ||
| workflows: | ||
| - name: main | ||
| primaryDescriptorPath: /parallel-accession-download.ga | ||
| subclass: Galaxy | ||
| publish: true | ||
| primaryDescriptorPath: /parallel-accession-download.ga | ||
| testParameterFiles: | ||
| - /parallel-accession-download-tests.yml | ||
| authors: | ||
| - name: Marius van den Beek | ||
| orcid: 0000-0002-9676-7032 | ||
| - name: IWC | ||
| url: https://github.com/galaxyproject/iwc |
10 changes: 10 additions & 0 deletions
10
workflows/data-fetching/parallel-accession-download/CHANGELOG.md
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
12 changes: 7 additions & 5 deletions
12
workflows/data-fetching/parallel-accession-download/test-data/SRR044777_head.fastq
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1,10 +1,12 @@ | ||
| @SRR044777.1 F47USSH02H1LGA length=160 | ||
| @F47USSH02H1LGA/4 | ||
| NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | ||
| +SRR044777.1 F47USSH02H1LGA length=160 | ||
| + | ||
| !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! | ||
| @SRR044777.2 F47USSH02GNP1D length=320 | ||
| @F47USSH02GNP1D/4 | ||
| CACGTAGTTAGCCGGTGCTTATTCTTCCGGTACCGTCAGCACGCAATGGTATTAACATCGCGCTTTTCTTCCCGGACAAAAGTCCTTTACAACCCGAAGGCCTTCTTCAGACACGCGGCATGGCTGGATCAGGGTTGCCCCCATTGTCCAAAATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCGGATCATCCTCTCAGACCCGCTACTGATCGTCGCCTTGGTAGGCCTTTACCCCACCAACCAGCTAATCAGATATCGGCCGCTCAAACAGCGCAAGGCACACAGGGGATAGGN | ||
| +SRR044777.2 F47USSH02GNP1D length=320 | ||
| + | ||
| IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIAAAAIIIHCCCCII@@@@IIIIHHHIIIIHHHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHHHIII?????IIIIIII@@@@HH6666IFIIIIIIIIHHHIIIIIIIIIIHHHIIIIIIIIIIIIHHHIIIIIIIIIIIIIIIIIIIIIIIICCCIIIIIIIIIIIIIIIIIIIIIIII??===?@B>>IDCIIIIIIIIIIIIIIIIIIIIIIIIIIIHHHIIIIIIHHHHIIIIII@@@@HIIII! | ||
| @SRR044777.3 F47USSH02JNWNH length=78 | ||
| @F47USSH02JNWNH/4 | ||
| GGCCATGCCTGTACCTGGGGTCCCTACTGAGCCAGGATCAAACTCTCTGAGACTGCCAAGGCACACAGGGGGATAGGN | ||
| + | ||
| AAIIIIIIIIIIIIIIACCCIHHHIIIIIIIIHHHHIIIHHHIIIIIIIIIIIIICCCCEAIIBB;4-----8<=<<! |
12 changes: 7 additions & 5 deletions
12
workflows/data-fetching/parallel-accession-download/test-data/SRR11953971_1_head.fastq
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1,10 +1,12 @@ | ||
| @SRR11953971.1 1 length=101 | ||
| @1/1 | ||
| GATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCG | ||
| +SRR11953971.1 1 length=101 | ||
| + | ||
| FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF | ||
| @SRR11953971.2 2 length=101 | ||
| @2/1 | ||
| GTGTAGAAGGCTCGAACGCAGTGACGAAGCTGGACGTATCCGCCGACCGGTAAAGGGTAAGGGTCTCAATGGCGTTACACGTAACAGCTCGACTGAACGCT | ||
| +SRR11953971.2 2 length=101 | ||
| + | ||
| FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF | ||
| @SRR11953971.3 3 length=101 | ||
| @3/1 | ||
| GTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGCTGTCTCTTATACACATCTCC | ||
| + | ||
| FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFF |
12 changes: 7 additions & 5 deletions
12
workflows/data-fetching/parallel-accession-download/test-data/SRR11953971_2_head.fastq
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1,10 +1,12 @@ | ||
| @SRR11953971.1 1 length=101 | ||
| @1/2 | ||
| TCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCAGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGA | ||
| +SRR11953971.1 1 length=101 | ||
| + | ||
| FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF | ||
| @SRR11953971.2 2 length=101 | ||
| @2/2 | ||
| GGAAATGAACTATATCGTAACCAAGCCGGGTAGCTGCTGTGGTGCTAGACTAGATGTTAGCGTTCAGTCGAGCTGTTACGTGTAACGCCATTGAGACCCTT | ||
| +SRR11953971.2 2 length=101 | ||
| + | ||
| FFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF:FFFFFFFFFF | ||
| @SRR11953971.3 3 length=101 | ||
| @3/2 | ||
| CACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACCTGTCTCTTATACACATCTGA | ||
| + | ||
| FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFF |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,29 @@ | ||
| version: 1.2 | ||
| workflows: | ||
| - name: consensus-peaks-chip-sr | ||
| subclass: Galaxy | ||
| publish: true | ||
| primaryDescriptorPath: /consensus-peaks-chip-sr.ga | ||
| testParameterFiles: | ||
| - /consensus-peaks-chip-sr-tests.yml | ||
| authors: | ||
| - name: Lucille Delisle | ||
| orcid: 0000-0002-1964-4960 | ||
| - name: consensus-peaks-chip-pe | ||
| subclass: Galaxy | ||
| publish: true | ||
| primaryDescriptorPath: /consensus-peaks-chip-pe.ga | ||
| testParameterFiles: | ||
| - /consensus-peaks-chip-pe-tests.yml | ||
| authors: | ||
| - name: Lucille Delisle | ||
| orcid: 0000-0002-1964-4960 | ||
| - name: consensus-peaks-atac-cutandrun | ||
| subclass: Galaxy | ||
| publish: true | ||
| primaryDescriptorPath: /consensus-peaks-atac-cutandrun.ga | ||
| testParameterFiles: | ||
| - /consensus-peaks-atac-cutandrun-tests.yml | ||
| authors: | ||
| - name: Lucille Delisle | ||
| orcid: 0000-0002-1964-4960 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,5 @@ | ||
| version: '0.1' | ||
| registries: | ||
| - url: https://workflowhub.eu | ||
| project: iwc | ||
| workflow: consensus-peaks/consensus-peaks-atac-cutandrun |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,4 @@ | ||
| # Changelog | ||
|
|
||
| ## [0.1] 2023-08-31 | ||
| First release. |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,29 @@ | ||
| # Consensus peaks Workflow | ||
|
|
||
| The goal of this workflow is to get a list of confident peaks with summits from two replicates. | ||
|
|
||
| ## Inputs dataset | ||
|
|
||
| - The workflow needs a single input which is a list of datasets with 2 BAM (or BED) where PCR duplicates have been removed. | ||
|
|
||
| ## Inputs values | ||
|
|
||
| - effective_genome_size: this is used by MACS2 and may be entered manually (indications are provided for heavily used genomes). | ||
| - bin_size: this is the bin sized used to compute the average of normalized profiles. Large values will allow to have a smaller output file but with less resolution while small values will increase computation time and size of the output file to produce a more resolutive bigwig. | ||
|
|
||
| ## Strategy summary | ||
|
|
||
| Here is a generated example to highlight the strategy: | ||
|  | ||
|
|
||
| ## Processing | ||
|
|
||
| - The workflow will: | ||
| - first part: | ||
| - call peaks and compute normalized coverage on each BAM (or BED) individually | ||
| - average normalized profiles | ||
| - compute the intersection between both peaks | ||
| - second part: | ||
| - subset both BAM (or BED) to get the same number of reads | ||
| - call peaks on both subsetted BAM combined | ||
| - finally, keep only peaks from the second part that have summits overlapping the intersection of the first part. |
52 changes: 52 additions & 0 deletions
52
workflows/epigenetics/consensus-peaks/consensus-peaks-atac-cutandrun-tests.yml
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,52 @@ | ||
| - doc: Test for consensus-peaks-atac-cutandrun.ga | ||
| job: | ||
| 2 rmDup bed: | ||
| class: Collection | ||
| collection_type: list | ||
| elements: | ||
| - class: File | ||
| identifier: rep1 | ||
| path: test-data/rep1.bed | ||
| dbkey: mm10 | ||
| - class: File | ||
| identifier: rep2 | ||
| path: test-data/rep2.bed | ||
| dbkey: mm10 | ||
| effective_genome_size: 1870000000 | ||
| bin_size: 50 | ||
| outputs: | ||
| individual_macs2_narrowPeaks: | ||
| element_tests: | ||
| rep1: | ||
| asserts: | ||
| has_n_lines: | ||
| n: 4 | ||
| delta: 1 | ||
| rep2: | ||
| asserts: | ||
| has_n_lines: | ||
| n: 4 | ||
| delta: 1 | ||
| strict_intersect_peaks: | ||
| asserts: | ||
| has_n_lines: | ||
| n: 4 | ||
| delta: 1 | ||
| average_bigwig: | ||
| asserts: | ||
| has_size: | ||
| value: 1388 | ||
| delta: 100 | ||
| merged_macs2_narrowPeaks: | ||
| asserts: | ||
| has_n_lines: | ||
| n: 5 | ||
| delta: 1 | ||
| multiqc_output: | ||
| asserts: | ||
| has_text: | ||
| text: "<span class=\"mqc_table_tooltip\" title=\"MACS2: Fragment Length\">Fragment Length</span>" | ||
| shared_narrowPeak: | ||
| asserts: | ||
| has_n_lines: | ||
| n: 3 |
Oops, something went wrong.