| Process Name | \\n\\", + " \\ Software | \\nVersion | \\n
|---|---|---|
| CUSTOM_DUMPSOFTWAREVERSIONS | \\npython | \\n\\", + " \\3.11.7 | \\n
| \\n \\", + " \\ | yaml | \\n5.4.1 | \\n
| TOOL1 | \\ntool1 | \\n\\", + " \\0.11.9 | \\n
| TOOL2 | \\n\\", + " \\tool2 | \\n1.9 | \\n
| Workflow | \\nNextflow | \\n\\" + ], + [ + "CUSTOM_DUMPSOFTWAREVERSIONS:", + " python: 3.11.7", + " yaml: 5.4.1", + "TOOL1:", + " tool1: 0.11.9", + "TOOL2:", + " tool2: '1.9'", + "Workflow:" + ] + ], + "timestamp": "2024-01-09T23:01:18.710682" + } +} \ No newline at end of file diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml new file mode 100644 index 0000000..405aa24 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml @@ -0,0 +1,2 @@ +custom/dumpsoftwareversions: + - modules/nf-core/custom/dumpsoftwareversions/** diff --git a/modules/nf-core/gunzip/environment.yml b/modules/nf-core/gunzip/environment.yml new file mode 100644 index 0000000..dfc02a7 --- /dev/null +++ b/modules/nf-core/gunzip/environment.yml @@ -0,0 +1,9 @@ +name: gunzip +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - conda-forge::grep=3.11 + - conda-forge::sed=4.8 + - conda-forge::tar=1.34 diff --git a/modules/nf-core/gunzip/main.nf b/modules/nf-core/gunzip/main.nf index e7189d2..5e67e3b 100644 --- a/modules/nf-core/gunzip/main.nf +++ b/modules/nf-core/gunzip/main.nf @@ -2,10 +2,10 @@ process GUNZIP { tag "$archive" label 'process_single' - conda "conda-forge::sed=4.7" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : - 'nf-core/ubuntu:20.04' }" + 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' : + 'nf-core/ubuntu:22.04' }" input: tuple val(meta), path(archive) @@ -18,13 +18,20 @@ process GUNZIP { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - gunzip = archive.toString() - '.gz' + def args = task.ext.args ?: '' + def extension = ( archive.toString() - '.gz' ).tokenize('.')[-1] + def name = archive.toString() - '.gz' - ".$extension" + def prefix = task.ext.prefix ?: name + gunzip = prefix + ".$extension" """ - gunzip \\ - -f \\ + # Not calling gunzip itself because it creates files + # with the original group ownership rather than the + # default one for that user / the work directory + gzip \\ + -cd \\ $args \\ - $archive + $archive \\ + > $gunzip cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -33,7 +40,11 @@ process GUNZIP { """ stub: - gunzip = archive.toString() - '.gz' + def args = task.ext.args ?: '' + def extension = ( archive.toString() - '.gz' ).tokenize('.')[-1] + def name = archive.toString() - '.gz' - ".$extension" + def prefix = task.ext.prefix ?: name + gunzip = prefix + ".$extension" """ touch $gunzip cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/gunzip/meta.yml b/modules/nf-core/gunzip/meta.yml index 4cdcdf4..f32973a 100644 --- a/modules/nf-core/gunzip/meta.yml +++ b/modules/nf-core/gunzip/meta.yml @@ -33,3 +33,8 @@ authors: - "@joseespinosa" - "@drpatelh" - "@jfy133" +maintainers: + - "@joseespinosa" + - "@drpatelh" + - "@jfy133" + - "@gallvp" diff --git a/modules/nf-core/gunzip/tests/main.nf.test b/modules/nf-core/gunzip/tests/main.nf.test new file mode 100644 index 0000000..776211a --- /dev/null +++ b/modules/nf-core/gunzip/tests/main.nf.test @@ -0,0 +1,121 @@ +nextflow_process { + + name "Test Process GUNZIP" + script "../main.nf" + process "GUNZIP" + tag "gunzip" + tag "modules_nfcore" + tag "modules" + + test("Should run without failures") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - prefix") { + + config './nextflow.config' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id: 'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - prefix - stub") { + + options '-stub' + config './nextflow.config' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id: 'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/gunzip/tests/main.nf.test.snap b/modules/nf-core/gunzip/tests/main.nf.test.snap new file mode 100644 index 0000000..069967e --- /dev/null +++ b/modules/nf-core/gunzip/tests/main.nf.test.snap @@ -0,0 +1,134 @@ +{ + "Should run without failures - prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:35:10.861293" + }, + "Should run without failures - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + [ + + ], + "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:35:05.857145" + }, + "Should run without failures": { + "content": [ + { + "0": [ + [ + [ + + ], + "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + [ + + ], + "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2023-10-17T15:35:37.690477896" + }, + "Should run without failures - prefix": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:33:32.921739" + } +} \ No newline at end of file diff --git a/modules/nf-core/gunzip/tests/nextflow.config b/modules/nf-core/gunzip/tests/nextflow.config new file mode 100644 index 0000000..dec7764 --- /dev/null +++ b/modules/nf-core/gunzip/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: GUNZIP { + ext.prefix = { "${meta.id}.xyz" } + } +} diff --git a/modules/nf-core/gunzip/tests/tags.yml b/modules/nf-core/gunzip/tests/tags.yml new file mode 100644 index 0000000..fd3f691 --- /dev/null +++ b/modules/nf-core/gunzip/tests/tags.yml @@ -0,0 +1,2 @@ +gunzip: + - modules/nf-core/gunzip/** diff --git a/modules/nf-core/minimap2/align/environment.yml b/modules/nf-core/minimap2/align/environment.yml new file mode 100644 index 0000000..41e8fe9 --- /dev/null +++ b/modules/nf-core/minimap2/align/environment.yml @@ -0,0 +1,11 @@ +name: minimap2_align + +channels: + - conda-forge + - bioconda + - defaults + +dependencies: + - bioconda::htslib=1.20 + - bioconda::minimap2=2.28 + - bioconda::samtools=1.20 diff --git a/modules/nf-core/minimap2/align/main.nf b/modules/nf-core/minimap2/align/main.nf index 4da47c1..d82dc14 100644 --- a/modules/nf-core/minimap2/align/main.nf +++ b/modules/nf-core/minimap2/align/main.nf @@ -1,45 +1,75 @@ process MINIMAP2_ALIGN { tag "$meta.id" - label 'process_medium' + label 'process_high' // Note: the versions here need to match the versions used in the mulled container below and minimap2/index - conda "bioconda::minimap2=2.24 bioconda::samtools=1.14" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:1679e915ddb9d6b4abda91880c4b48857d471bd8-0' : - 'biocontainers/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:1679e915ddb9d6b4abda91880c4b48857d471bd8-0' }" + 'https://depot.galaxyproject.org/singularity/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:3161f532a5ea6f1dec9be5667c9efc2afdac6104-0' : + 'biocontainers/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:3161f532a5ea6f1dec9be5667c9efc2afdac6104-0' }" input: tuple val(meta), path(reads) - path reference + tuple val(meta2), path(reference) val bam_format + val bam_index_extension val cigar_paf_format val cigar_bam output: - tuple val(meta), path("*.paf"), optional: true, emit: paf - tuple val(meta), path("*.bam"), optional: true, emit: bam - path "versions.yml" , emit: versions + tuple val(meta), path("*.paf") , optional: true, emit: paf + tuple val(meta), path("*.bam") , optional: true, emit: bam + tuple val(meta), path("*.bam.${bam_index_extension}"), optional: true, emit: index + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' + def args = task.ext.args ?: '' + def args2 = task.ext.args2 ?: '' + def args3 = task.ext.args3 ?: '' + def args4 = task.ext.args4 ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def bam_output = bam_format ? "-a | samtools sort | samtools view -@ ${task.cpus} -b -h -o ${prefix}.bam" : "-o ${prefix}.paf" + def bam_index = bam_index_extension ? "${prefix}.bam##idx##${prefix}.bam.${bam_index_extension} --write-index" : "${prefix}.bam" + def bam_output = bam_format ? "-a | samtools sort -@ ${task.cpus-1} -o ${bam_index} ${args2}" : "-o ${prefix}.paf" def cigar_paf = cigar_paf_format && !bam_format ? "-c" : '' def set_cigar_bam = cigar_bam && bam_format ? "-L" : '' + def bam_input = "${reads.extension}".matches('sam|bam|cram') + def samtools_reset_fastq = bam_input ? "samtools reset --threads ${task.cpus-1} $args3 $reads | samtools fastq --threads ${task.cpus-1} $args4 |" : '' + def query = bam_input ? "-" : reads + def target = reference ?: (bam_input ? error("BAM input requires reference") : reads) + """ + $samtools_reset_fastq \\ minimap2 \\ $args \\ -t $task.cpus \\ - "${reference ?: reads}" \\ - "$reads" \\ + $target \\ + $query \\ $cigar_paf \\ $set_cigar_bam \\ $bam_output + cat <<-END_VERSIONS > versions.yml + "${task.process}": + minimap2: \$(minimap2 --version 2>&1) + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + def output_file = bam_format ? "${prefix}.bam" : "${prefix}.paf" + def bam_index = bam_index_extension ? "touch ${prefix}.bam.${bam_index_extension}" : "" + def bam_input = "${reads.extension}".matches('sam|bam|cram') + def target = reference ?: (bam_input ? error("BAM input requires reference") : reads) + + """ + touch $output_file + ${bam_index} + cat <<-END_VERSIONS > versions.yml "${task.process}": minimap2: \$(minimap2 --version 2>&1) diff --git a/modules/nf-core/minimap2/align/meta.yml b/modules/nf-core/minimap2/align/meta.yml index 991b39a..8996f88 100644 --- a/modules/nf-core/minimap2/align/meta.yml +++ b/modules/nf-core/minimap2/align/meta.yml @@ -25,6 +25,11 @@ input: description: | List of input FASTA or FASTQ files of size 1 and 2 for single-end and paired-end data, respectively. + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test_ref'] - reference: type: file description: | @@ -32,6 +37,9 @@ input: - bam_format: type: boolean description: Specify that output should be in BAM format + - bam_index_extension: + type: string + description: BAM alignment index extension (e.g. "bai") - cigar_paf_format: type: boolean description: Specify that output CIGAR should be in PAF format @@ -54,6 +62,10 @@ output: type: file description: Alignment in BAM format pattern: "*.bam" + - index: + type: file + description: BAM alignment index + pattern: "*.bam.*" - versions: type: file description: File containing software versions @@ -63,3 +75,10 @@ authors: - "@sofstam" - "@sateeshperi" - "@jfy133" + - "@fellen31" +maintainers: + - "@heuermh" + - "@sofstam" + - "@sateeshperi" + - "@jfy133" + - "@fellen31" diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test b/modules/nf-core/minimap2/align/tests/main.nf.test new file mode 100644 index 0000000..4072c17 --- /dev/null +++ b/modules/nf-core/minimap2/align/tests/main.nf.test @@ -0,0 +1,441 @@ +nextflow_process { + + name "Test Process MINIMAP2_ALIGN" + script "../main.nf" + process "MINIMAP2_ALIGN" + + tag "modules" + tag "modules_nfcore" + tag "minimap2" + tag "minimap2/align" + + test("sarscov2 - fastq, fasta, true, [], false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, fasta, true, 'bai', false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + file(process.out.index[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], fasta, true, false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, [], true, false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + ] + input[1] = [ + [ id:'test_ref' ], // meta map + [] + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, [], false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, 'bai', false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + bam(process.out.bam[0][1]).getHeader(), + bam(process.out.bam[0][1]).getReadsMD5(), + file(process.out.index[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - bam, [], true, false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + [] + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.failed } + ) + } + + } + + test("sarscov2 - fastq, fasta, true, [], false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - fastq, fasta, true, 'bai', false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - fastq, fasta, false, [], false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = false + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, [], false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam, fasta, true, 'bai', false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + input[2] = true + input[3] = 'bai' + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam, [], true, false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test3.single_end.markduplicates.sorted.bam', checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + [] + ] + input[2] = true + input[3] = [] + input[4] = false + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.failed } + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test.snap b/modules/nf-core/minimap2/align/tests/main.nf.test.snap new file mode 100644 index 0000000..12264a8 --- /dev/null +++ b/modules/nf-core/minimap2/align/tests/main.nf.test.snap @@ -0,0 +1,476 @@ +{ + "sarscov2 - bam, fasta, true, 'bai', false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta -", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam##idx##test.bam.bai --write-index" + ], + "5d426b9a5f5b2c54f1d7f1e4c238ae94", + "test.bam.bai", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-25T09:03:00.827260362" + }, + "sarscov2 - bam, fasta, true, 'bai', false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:21:37.92353539" + }, + "sarscov2 - fastq, fasta, true, 'bai', false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-03T11:29:44.669021368" + }, + "sarscov2 - fastq, fasta, false, [], false, false - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + + ], + "index": [ + + ], + "paf": [ + [ + { + "id": "test", + "single_end": true + }, + "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-03T11:15:52.738781039" + }, + "sarscov2 - fastq, fasta, true, [], false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-03T11:15:23.033808223" + }, + "sarscov2 - [fastq1, fastq2], fasta, true, false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz test_2.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "1bc392244f228bf52cf0b5a8f6a654c9", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:18:18.964586894" + }, + "sarscov2 - fastq, fasta, true, [], false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "f194745c0ccfcb2a9c0aee094a08750", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:17:48.667488325" + }, + "sarscov2 - fastq, fasta, true, 'bai', false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta test_1.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam##idx##test.bam.bai --write-index" + ], + "f194745c0ccfcb2a9c0aee094a08750", + "test.bam.bai", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:18:02.517416733" + }, + "sarscov2 - bam, fasta, true, [], false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:MT192765.1\tLN:29829", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a genome.fasta -", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "5d426b9a5f5b2c54f1d7f1e4c238ae94", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-25T09:02:49.64829488" + }, + "sarscov2 - bam, fasta, true, [], false, false - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "index": [ + + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,98b8f5f36aa54b82210094f0b0d11938" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:21:22.162291795" + }, + "sarscov2 - fastq, [], true, false, false": { + "content": [ + [ + "@HD\tVN:1.6\tSO:coordinate", + "@SQ\tSN:ERR5069949.2151832\tLN:150", + "@SQ\tSN:ERR5069949.576388\tLN:77", + "@SQ\tSN:ERR5069949.501486\tLN:146", + "@SQ\tSN:ERR5069949.1331889\tLN:132", + "@SQ\tSN:ERR5069949.2161340\tLN:80", + "@SQ\tSN:ERR5069949.973930\tLN:79", + "@SQ\tSN:ERR5069949.2417063\tLN:150", + "@SQ\tSN:ERR5069949.376959\tLN:151", + "@SQ\tSN:ERR5069949.1088785\tLN:149", + "@SQ\tSN:ERR5069949.1066259\tLN:147", + "@SQ\tSN:ERR5069949.2832676\tLN:139", + "@SQ\tSN:ERR5069949.2953930\tLN:151", + "@SQ\tSN:ERR5069949.324865\tLN:151", + "@SQ\tSN:ERR5069949.2185111\tLN:150", + "@SQ\tSN:ERR5069949.937422\tLN:151", + "@SQ\tSN:ERR5069949.2431709\tLN:150", + "@SQ\tSN:ERR5069949.1246538\tLN:148", + "@SQ\tSN:ERR5069949.1189252\tLN:98", + "@SQ\tSN:ERR5069949.2216307\tLN:147", + "@SQ\tSN:ERR5069949.3273002\tLN:148", + "@SQ\tSN:ERR5069949.3277445\tLN:151", + "@SQ\tSN:ERR5069949.3022231\tLN:147", + "@SQ\tSN:ERR5069949.184542\tLN:151", + "@SQ\tSN:ERR5069949.540529\tLN:149", + "@SQ\tSN:ERR5069949.686090\tLN:150", + "@SQ\tSN:ERR5069949.2787556\tLN:106", + "@SQ\tSN:ERR5069949.2650879\tLN:150", + "@SQ\tSN:ERR5069949.2064910\tLN:149", + "@SQ\tSN:ERR5069949.2328704\tLN:150", + "@SQ\tSN:ERR5069949.1067032\tLN:150", + "@SQ\tSN:ERR5069949.3338256\tLN:151", + "@SQ\tSN:ERR5069949.1412839\tLN:147", + "@SQ\tSN:ERR5069949.1538968\tLN:150", + "@SQ\tSN:ERR5069949.147998\tLN:94", + "@SQ\tSN:ERR5069949.366975\tLN:106", + "@SQ\tSN:ERR5069949.1372331\tLN:151", + "@SQ\tSN:ERR5069949.1709367\tLN:129", + "@SQ\tSN:ERR5069949.2388984\tLN:150", + "@SQ\tSN:ERR5069949.1132353\tLN:150", + "@SQ\tSN:ERR5069949.1151736\tLN:151", + "@SQ\tSN:ERR5069949.479807\tLN:150", + "@SQ\tSN:ERR5069949.2176303\tLN:151", + "@SQ\tSN:ERR5069949.2772897\tLN:151", + "@SQ\tSN:ERR5069949.1020777\tLN:122", + "@SQ\tSN:ERR5069949.465452\tLN:151", + "@SQ\tSN:ERR5069949.1704586\tLN:149", + "@SQ\tSN:ERR5069949.1258508\tLN:151", + "@SQ\tSN:ERR5069949.986441\tLN:119", + "@SQ\tSN:ERR5069949.2674295\tLN:148", + "@SQ\tSN:ERR5069949.885966\tLN:79", + "@SQ\tSN:ERR5069949.2342766\tLN:151", + "@SQ\tSN:ERR5069949.3122970\tLN:127", + "@SQ\tSN:ERR5069949.3279513\tLN:72", + "@SQ\tSN:ERR5069949.309410\tLN:151", + "@SQ\tSN:ERR5069949.532979\tLN:149", + "@SQ\tSN:ERR5069949.2888794\tLN:151", + "@SQ\tSN:ERR5069949.2205229\tLN:150", + "@SQ\tSN:ERR5069949.786562\tLN:151", + "@SQ\tSN:ERR5069949.919671\tLN:151", + "@SQ\tSN:ERR5069949.1328186\tLN:151", + "@SQ\tSN:ERR5069949.870926\tLN:149", + "@SQ\tSN:ERR5069949.2257580\tLN:151", + "@SQ\tSN:ERR5069949.3249622\tLN:77", + "@SQ\tSN:ERR5069949.611123\tLN:125", + "@SQ\tSN:ERR5069949.651338\tLN:142", + "@SQ\tSN:ERR5069949.169513\tLN:92", + "@SQ\tSN:ERR5069949.155944\tLN:150", + "@SQ\tSN:ERR5069949.2033605\tLN:150", + "@SQ\tSN:ERR5069949.2730382\tLN:142", + "@SQ\tSN:ERR5069949.2125592\tLN:150", + "@SQ\tSN:ERR5069949.1062611\tLN:151", + "@SQ\tSN:ERR5069949.1778133\tLN:151", + "@SQ\tSN:ERR5069949.3057020\tLN:95", + "@SQ\tSN:ERR5069949.2972968\tLN:141", + "@SQ\tSN:ERR5069949.2734474\tLN:149", + "@SQ\tSN:ERR5069949.856527\tLN:151", + "@SQ\tSN:ERR5069949.2098070\tLN:151", + "@SQ\tSN:ERR5069949.1552198\tLN:150", + "@SQ\tSN:ERR5069949.2385514\tLN:150", + "@SQ\tSN:ERR5069949.2270078\tLN:151", + "@SQ\tSN:ERR5069949.114870\tLN:150", + "@SQ\tSN:ERR5069949.2668880\tLN:147", + "@SQ\tSN:ERR5069949.257821\tLN:139", + "@SQ\tSN:ERR5069949.2243023\tLN:150", + "@SQ\tSN:ERR5069949.2605155\tLN:146", + "@SQ\tSN:ERR5069949.1340552\tLN:151", + "@SQ\tSN:ERR5069949.1561137\tLN:150", + "@SQ\tSN:ERR5069949.2361683\tLN:149", + "@SQ\tSN:ERR5069949.2521353\tLN:150", + "@SQ\tSN:ERR5069949.1261808\tLN:149", + "@SQ\tSN:ERR5069949.2734873\tLN:98", + "@SQ\tSN:ERR5069949.3017828\tLN:107", + "@SQ\tSN:ERR5069949.573706\tLN:150", + "@SQ\tSN:ERR5069949.1980512\tLN:151", + "@SQ\tSN:ERR5069949.1014693\tLN:150", + "@SQ\tSN:ERR5069949.3184655\tLN:150", + "@SQ\tSN:ERR5069949.29668\tLN:89", + "@SQ\tSN:ERR5069949.3258358\tLN:151", + "@SQ\tSN:ERR5069949.1476386\tLN:151", + "@SQ\tSN:ERR5069949.2415814\tLN:150", + "@PG\tID:minimap2\tPN:minimap2\tVN:2.28-r1209\tCL:minimap2 -t 2 -a test_1.fastq.gz test_1.fastq.gz", + "@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.20\tCL:samtools sort -@ 1 -o test.bam" + ], + "16c1c651f8ec67383bcdee3c55aed94f", + [ + "versions.yml:md5,3548eeba9066efbf8d78ea99f8d813fd" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-23T11:18:34.246998277" + } +} \ No newline at end of file diff --git a/modules/nf-core/minimap2/align/tests/tags.yml b/modules/nf-core/minimap2/align/tests/tags.yml new file mode 100644 index 0000000..39dba37 --- /dev/null +++ b/modules/nf-core/minimap2/align/tests/tags.yml @@ -0,0 +1,2 @@ +minimap2/align: + - "modules/nf-core/minimap2/align/**" diff --git a/modules/nf-core/samtools/collate/main.nf b/modules/nf-core/samtools/collate/main.nf deleted file mode 100644 index b23246b..0000000 --- a/modules/nf-core/samtools/collate/main.nf +++ /dev/null @@ -1,46 +0,0 @@ -process SAMTOOLS_COLLATE { - tag "$meta.id" - label 'process_medium' - - conda "bioconda::samtools=1.17" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0': - 'biocontainers/samtools:1.17--h00cdaf9_0' }" - - input: - tuple val(meta), path(input) - path fasta - - output: - tuple val(meta), path("*.bam"), emit: bam, optional: true - tuple val(meta), path("*.cram"), emit: cram, optional: true - tuple val(meta), path("*.sam"), emit: sam, optional: true - path "versions.yml", emit: versions - - when: - task.ext.when == null || task.ext.when - - script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - def reference = fasta ? "--reference ${fasta}" : "" - def extension = args.contains("--output-fmt sam") ? "sam" : - args.contains("--output-fmt bam") ? "bam" : - args.contains("--output-fmt cram") ? "cram" : - "bam" - if ("$input" == "${prefix}.${extension}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" - """ - samtools \\ - collate \\ - $args \\ - ${reference} \\ - -@ $task.cpus \\ - -o ${prefix}.${extension} \\ - $input - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') - END_VERSIONS - """ -} diff --git a/modules/nf-core/samtools/collate/meta.yml b/modules/nf-core/samtools/collate/meta.yml deleted file mode 100644 index 0e78403..0000000 --- a/modules/nf-core/samtools/collate/meta.yml +++ /dev/null @@ -1,44 +0,0 @@ -name: "samtools_collate" -description: shuffles and groups reads together by their names -keywords: - - collate - - bam -tools: - - "samtools": - description: "Tools for dealing with SAM, BAM and CRAM files" - homepage: "http://www.htslib.org" - documentation: "https://www.htslib.org/doc/samtools-collate.html" - tool_dev_url: "https://github.com/samtools/samtools" - doi: "10.1093/bioinformatics/btp352" - licence: "['MIT']" - -input: - # Only when we have meta - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - input: - type: file - description: BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" - -output: - #Only when we have meta - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - output: - type: file - description: Collated BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" - -authors: - - "@priyanka-surana" diff --git a/modules/nf-core/samtools/faidx/environment.yml b/modules/nf-core/samtools/faidx/environment.yml new file mode 100644 index 0000000..f8450fa --- /dev/null +++ b/modules/nf-core/samtools/faidx/environment.yml @@ -0,0 +1,10 @@ +name: samtools_faidx + +channels: + - conda-forge + - bioconda + - defaults + +dependencies: + - bioconda::htslib=1.20 + - bioconda::samtools=1.20 diff --git a/modules/nf-core/samtools/faidx/main.nf b/modules/nf-core/samtools/faidx/main.nf index 59ed308..bdcdbc9 100644 --- a/modules/nf-core/samtools/faidx/main.nf +++ b/modules/nf-core/samtools/faidx/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_FAIDX { tag "$fasta" label 'process_single' - conda "bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.20--h50ea8bc_0' : + 'biocontainers/samtools:1.20--h50ea8bc_0' }" input: tuple val(meta), path(fasta) diff --git a/modules/nf-core/samtools/faidx/meta.yml b/modules/nf-core/samtools/faidx/meta.yml index 957b25e..f3c25de 100644 --- a/modules/nf-core/samtools/faidx/meta.yml +++ b/modules/nf-core/samtools/faidx/meta.yml @@ -39,6 +39,10 @@ output: description: | Groovy Map containing sample information e.g. [ id:'test', single_end:false ] + - fa: + type: file + description: FASTA file + pattern: "*.{fa}" - fai: type: file description: FASTA index file @@ -55,3 +59,7 @@ authors: - "@drpatelh" - "@ewels" - "@phue" +maintainers: + - "@drpatelh" + - "@ewels" + - "@phue" diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test b/modules/nf-core/samtools/faidx/tests/main.nf.test new file mode 100644 index 0000000..17244ef --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/main.nf.test @@ -0,0 +1,122 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FAIDX" + script "../main.nf" + process "SAMTOOLS_FAIDX" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/faidx" + + test("test_samtools_faidx") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_bgzip") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true)] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_fasta") { + + config "./nextflow.config" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_stub_fasta") { + + config "./nextflow2.config" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_stub_fai") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test.snap b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap new file mode 100644 index 0000000..3223b72 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap @@ -0,0 +1,249 @@ +{ + "test_samtools_faidx": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,2db78952923a61e05d50b95518b21856" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,2db78952923a61e05d50b95518b21856" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-28T15:42:14.779784761" + }, + "test_samtools_faidx_bgzip": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "3": [ + "versions.yml:md5,2db78952923a61e05d50b95518b21856" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "versions": [ + "versions.yml:md5,2db78952923a61e05d50b95518b21856" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-28T15:42:20.256633877" + }, + "test_samtools_faidx_fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,6a0774a0ad937ba0bfd2ac7457d90f36" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,2db78952923a61e05d50b95518b21856" + ], + "fa": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,6a0774a0ad937ba0bfd2ac7457d90f36" + ] + ], + "fai": [ + + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,2db78952923a61e05d50b95518b21856" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-28T15:42:25.632577273" + }, + "test_samtools_faidx_stub_fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,2db78952923a61e05d50b95518b21856" + ], + "fa": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "fai": [ + + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,2db78952923a61e05d50b95518b21856" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-28T15:42:31.058424849" + }, + "test_samtools_faidx_stub_fai": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,2db78952923a61e05d50b95518b21856" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,2db78952923a61e05d50b95518b21856" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-28T15:42:36.479929617" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/nextflow.config b/modules/nf-core/samtools/faidx/tests/nextflow.config new file mode 100644 index 0000000..f76a3ba --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_FAIDX { + ext.args = 'MT192765.1 -o extract.fa' + } + +} diff --git a/modules/nf-core/samtools/faidx/tests/nextflow2.config b/modules/nf-core/samtools/faidx/tests/nextflow2.config new file mode 100644 index 0000000..33ebbd5 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/nextflow2.config @@ -0,0 +1,6 @@ +process { + + withName: SAMTOOLS_FAIDX { + ext.args = '-o extract.fa' + } +} diff --git a/modules/nf-core/samtools/faidx/tests/tags.yml b/modules/nf-core/samtools/faidx/tests/tags.yml new file mode 100644 index 0000000..e4a8394 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/faidx: + - modules/nf-core/samtools/faidx/** diff --git a/modules/nf-core/samtools/fasta/main.nf b/modules/nf-core/samtools/fasta/main.nf deleted file mode 100644 index 3145965..0000000 --- a/modules/nf-core/samtools/fasta/main.nf +++ /dev/null @@ -1,44 +0,0 @@ -process SAMTOOLS_FASTA { - tag "$meta.id" - label 'process_low' - - conda "bioconda::samtools=1.17" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" - - input: - tuple val(meta), path(input) - val(interleave) - - output: - tuple val(meta), path("*_{1,2}.fasta.gz") , optional:true, emit: fasta - tuple val(meta), path("*_interleaved.fasta.gz"), optional:true, emit: interleaved - tuple val(meta), path("*_singleton.fasta.gz") , optional:true, emit: singleton - tuple val(meta), path("*_other.fasta.gz") , optional:true, emit: other - path "versions.yml" , emit: versions - - when: - task.ext.when == null || task.ext.when - - script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - def output = ( interleave && ! meta.single_end ) ? "> ${prefix}_interleaved.fasta.gz" : - meta.single_end ? "-1 ${prefix}_1.fasta.gz -s ${prefix}_singleton.fasta.gz" : - "-1 ${prefix}_1.fasta.gz -2 ${prefix}_2.fasta.gz -s ${prefix}_singleton.fasta.gz" - """ - samtools \\ - fasta \\ - $args \\ - --threads ${task.cpus-1} \\ - -0 ${prefix}_other.fasta.gz \\ - $input \\ - $output - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//' )) - END_VERSIONS - """ -} diff --git a/modules/nf-core/samtools/fasta/meta.yml b/modules/nf-core/samtools/fasta/meta.yml deleted file mode 100644 index 8e45986..0000000 --- a/modules/nf-core/samtools/fasta/meta.yml +++ /dev/null @@ -1,61 +0,0 @@ -name: "samtools_fasta" -description: Converts a SAM/BAM/CRAM file to FASTA -keywords: - - bam - - sam - - cram - - fasta -tools: - - "samtools": - description: "Tools for dealing with SAM, BAM and CRAM files" - homepage: "http://www.htslib.org" - documentation: "https://www.htslib.org/doc/samtools-fasta.html" - tool_dev_url: "https://github.com/samtools/samtools" - doi: "10.1093/bioinformatics/btp352" - licence: "['MIT']" - -input: - # Only when we have meta - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - input: - type: file - description: BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" - - interleave: - type: boolean - description: Set true for interleaved fasta files - -output: - #Only when we have meta - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - fasta: - type: file - description: Compressed FASTA file(s) with reads with either the READ1 or READ2 flag set in separate files. - pattern: "*_{1,2}.fasta.gz" - - interleaved: - type: file - description: Compressed FASTA file with reads with either the READ1 or READ2 flag set in a combined file. Needs collated input file. - pattern: "*_interleaved.fasta.gz" - - singleton: - type: file - description: Compressed FASTA file with singleton reads - pattern: "*_singleton.fasta.gz" - - other: - type: file - description: Compressed FASTA file with reads with either both READ1 and READ2 flags set or unset - pattern: "*_other.fasta.gz" - -authors: - - "@priyanka-surana" diff --git a/modules/nf-core/samtools/fastq/environment.yml b/modules/nf-core/samtools/fastq/environment.yml new file mode 100644 index 0000000..4455904 --- /dev/null +++ b/modules/nf-core/samtools/fastq/environment.yml @@ -0,0 +1,8 @@ +name: samtools_fastq +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.20 + - bioconda::htslib=1.20 diff --git a/modules/nf-core/samtools/fastq/main.nf b/modules/nf-core/samtools/fastq/main.nf index 15d8976..6796c02 100644 --- a/modules/nf-core/samtools/fastq/main.nf +++ b/modules/nf-core/samtools/fastq/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_FASTQ { tag "$meta.id" label 'process_low' - conda "bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.20--h50ea8bc_0' : + 'biocontainers/samtools:1.20--h50ea8bc_0' }" input: tuple val(meta), path(input) @@ -13,7 +13,7 @@ process SAMTOOLS_FASTQ { output: tuple val(meta), path("*_{1,2}.fastq.gz") , optional:true, emit: fastq - tuple val(meta), path("*_interleaved.fastq.gz"), optional:true, emit: interleaved + tuple val(meta), path("*_interleaved.fastq") , optional:true, emit: interleaved tuple val(meta), path("*_singleton.fastq.gz") , optional:true, emit: singleton tuple val(meta), path("*_other.fastq.gz") , optional:true, emit: other path "versions.yml" , emit: versions @@ -24,7 +24,7 @@ process SAMTOOLS_FASTQ { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def output = ( interleave && ! meta.single_end ) ? "> ${prefix}_interleaved.fastq.gz" : + def output = ( interleave && ! meta.single_end ) ? "> ${prefix}_interleaved.fastq" : meta.single_end ? "-1 ${prefix}_1.fastq.gz -s ${prefix}_singleton.fastq.gz" : "-1 ${prefix}_1.fastq.gz -2 ${prefix}_2.fastq.gz -s ${prefix}_singleton.fastq.gz" """ diff --git a/modules/nf-core/samtools/fastq/meta.yml b/modules/nf-core/samtools/fastq/meta.yml index b1a1ed3..c4002a4 100644 --- a/modules/nf-core/samtools/fastq/meta.yml +++ b/modules/nf-core/samtools/fastq/meta.yml @@ -15,7 +15,6 @@ tools: documentation: http://www.htslib.org/doc/samtools.html doi: 10.1093/bioinformatics/btp352 licence: ["MIT"] - input: - meta: type: map @@ -29,7 +28,6 @@ input: - interleave: type: boolean description: Set true for interleaved fastq file - output: - meta: type: map @@ -56,7 +54,9 @@ output: type: file description: Compressed FASTQ file with reads with either both READ1 and READ2 flags set or unset pattern: "*_other.fastq.gz" - authors: - "@priyanka-surana" - "@suzannejin" +maintainers: + - "@priyanka-surana" + - "@suzannejin" diff --git a/modules/nf-core/samtools/fastq/tests/main.nf.test b/modules/nf-core/samtools/fastq/tests/main.nf.test new file mode 100644 index 0000000..f6ac112 --- /dev/null +++ b/modules/nf-core/samtools/fastq/tests/main.nf.test @@ -0,0 +1,67 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FASTQ" + script "../main.nf" + process "SAMTOOLS_FASTQ" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/fastq" + + test("bam") { + + when { + process { + """ + interleave = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = interleave + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.fastq[0][1].collect { path(it).linesGzip[0..6] }).match("bam_fastq") }, + { assert snapshot(process.out.interleaved).match("bam_interleaved") }, + { assert snapshot(file(process.out.singleton[0][1]).name).match("bam_singleton") }, + { assert snapshot(file(process.out.other[0][1]).name).match("bam_other") }, + { assert snapshot(process.out.versions).match("bam_versions") } + ) + } + } + + test("bam_interleave") { + + when { + process { + """ + interleave = true + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = interleave + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.fastq).match("bam_interleave_fastq") }, + { assert snapshot(path(process.out.interleaved[0][1]).readLines()[0..6]).match("bam_interlinterleave_eaved") }, + { assert snapshot(process.out.singleton).match("bam_singinterleave_leton") }, + { assert snapshot(file(process.out.other[0][1]).name).match("bam_interleave_other") }, + { assert snapshot(process.out.versions).match("bam_verinterleave_sions") } + ) + } + } +} diff --git a/modules/nf-core/samtools/fastq/tests/main.nf.test.snap b/modules/nf-core/samtools/fastq/tests/main.nf.test.snap new file mode 100644 index 0000000..1ba09d3 --- /dev/null +++ b/modules/nf-core/samtools/fastq/tests/main.nf.test.snap @@ -0,0 +1,139 @@ +{ + "bam_interlinterleave_eaved": { + "content": [ + [ + "@ERR5069949.2151832/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "+", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE