Two short contigs, indexed and with sequence dictionary, to facilitat…

…e testing
mcveanlab · Sep 1, 2017 · 925b2a8 · 925b2a8
1 parent 4143ed6
commit 925b2a8
Show file tree

Hide file tree

Showing 3 changed files with 9 additions and 0 deletions.
diff --git a/tests/two_short_contigs.fa b/tests/two_short_contigs.fa
@@ -0,0 +1,4 @@
+>1
+TTCTGTATCGTATGCTCTGAATAAAAATCGTGGCCCTATTTCGTATAGT
+>2
+GGGCCGCGCCTATTATGGGCTTCTCTCTGAGTACTGGTCATGTAGTTGCTGTAGTCGTAGTGTCGTGGCCCCCCAGT
diff --git a/tests/two_short_contigs.fa.dict b/tests/two_short_contigs.fa.dict
@@ -0,0 +1,3 @@
+@HD	VN:1.0	SO:unsorted
+@SQ	SN:1	LN:49	M5:21ca4bb1bef83008283ee8004e655108	UR:file:///Users/kiran/repositories/INDIANA/tests/two_short_contigs.fa
+@SQ	SN:2	LN:77	M5:9d7185f45ffaa0cff06179aaacd77435	UR:file:///Users/kiran/repositories/INDIANA/tests/two_short_contigs.fa
diff --git a/tests/two_short_contigs.fa.fai b/tests/two_short_contigs.fa.fai
@@ -0,0 +1,2 @@
+1	49	3	49	50
+2	77	56	77	78