diff --git a/workflows/epigenetics/chipseq-pe-with-replicates-controls/.dockstore.yml b/workflows/epigenetics/chipseq-pe-with-replicates-controls/.dockstore.yml new file mode 100644 index 000000000..9cf868614 --- /dev/null +++ b/workflows/epigenetics/chipseq-pe-with-replicates-controls/.dockstore.yml @@ -0,0 +1,11 @@ +version: 1.2 +workflows: +- name: main + subclass: Galaxy + publish: true + primaryDescriptorPath: /chipseq-pe-with-replicates-controls.ga + testParameterFiles: + - /chipseq-pe-with-replicates-controls-tests.yml + authors: + - name: Wolfgang Maier + orcid: 0000-0002-9464-6640 diff --git a/workflows/epigenetics/chipseq-pe-with-replicates-controls/.workflowhub.yml b/workflows/epigenetics/chipseq-pe-with-replicates-controls/.workflowhub.yml new file mode 100644 index 000000000..64a998bcc --- /dev/null +++ b/workflows/epigenetics/chipseq-pe-with-replicates-controls/.workflowhub.yml @@ -0,0 +1,5 @@ +version: '0.1' +registries: +- url: https://workflowhub.eu + project: iwc + workflow: chipseq-pe-with-replicates-controls/main diff --git a/workflows/epigenetics/chipseq-pe-with-replicates-controls/CHANGELOG.md b/workflows/epigenetics/chipseq-pe-with-replicates-controls/CHANGELOG.md new file mode 100644 index 000000000..c4efbee87 --- /dev/null +++ b/workflows/epigenetics/chipseq-pe-with-replicates-controls/CHANGELOG.md @@ -0,0 +1,5 @@ +# Changelog + +## [0.1] 2024-10-22 + +Initial release diff --git a/workflows/epigenetics/chipseq-pe-with-replicates-controls/README.md b/workflows/epigenetics/chipseq-pe-with-replicates-controls/README.md new file mode 100644 index 000000000..31f97c2b7 --- /dev/null +++ b/workflows/epigenetics/chipseq-pe-with-replicates-controls/README.md @@ -0,0 +1,62 @@ +# Quality control, mapping and peaks identification for ChIP-Seq replicates with controls + +This workflow is for analyzing batches of ChIP-Seq samples with controls and replicates from paired-end sequenced reads to called peaks. + +It uses: +- **fastp** for sequenced reads pre-processing, +- **bowtie2** for mapping +- **MACS2** for peak calling +- **deeptools** for cross-sample correlation and averaging + +The workflow provides quality control at the level of sequenced reads, mapping results and called peaks, and visualizes correlation between samples. + +## Input datasets + +- **Sequencing data**: this must be provided as a single list collection of paired fastq datasets of all samples. +- **Sample sheet**: this is expected to be a 4-column tabular dataset that describes samples, their association with each other and with conditions and replicates. + + The first column of the file must list all samples with their names matching the element names in the Sequencing data collection. Samples can be listed in any order. + The second column is used to specify the specific experimental condition that each sample represents. There is no formal restriction on this column, but values should be kept short for readable reports. + The third column is used to specify the replicate that each sample belongs to. There is no formal restriction to replicate identifiers, but they should be kept as short as possible. At least two replicates are required per condition, but different conditions can have different numbers of replicates. + The fourth column must provide the name of the sample that serves as the control for the sample described on each line. Different samples can be associated with the same control sample. + Control samples must also be listed on their own lines just like regular samples, but must use . or - as the value of the fourth column. The value of the third column (replicate ID) is ignored for control sample lines so may also be set to . or -. + + Here's an example sample sheet: + + SRR5680995 input - - + SRR5680996 H3K4me3 rep1 SRR5680995 + SRR5680997 H3K27me3 rep1 SRR5680995 + SRR5681007 H3K27me3 rep2 SRR5681005 + SRR5681006 H3K4me3 rep2 SRR5681005 + SRR5680998 CTCF rep1 SRR5680995 + SRR5681008 CTCF rep2 SRR5681005 + SRR5681005 input - - + + This declares an experimental design with three conditions - H3K4me3, H3K27me3 and CTCF - with two replicates per condition and one input control per replicate. The control sample SRR5680995 is declared as the shared control for all samples from replicate rep1, SRR5681005 as the control for all samples from replicate rep2. + + When importing the sample sheet into Galaxy make sure you are using Tab characters as the column separators. + +## Input parameters + +- **Reference genome**: set this to the reference genome of your organism of interest; used at the read mapping step +- **Sequencing adapter - forward** (optional) +- **Sequencing adapter - reverse** (optional) +- **Effective genome size**: this is used by MACS2 and may be entered manually (indications are provided for heavily used genomes). +- **Average size of sequenced fragments**: used for deeptools-based QC + +## Outputs: + +- **MultiQC analysis reports**: contains key quality metrics from the fastp, bowtie2 and MACS2 steps of the workflow +- **Sample fingerprints**: plot comparing IP strengths for all samples + (see https://deeptools.readthedocs.io/en/latest/content/tools/plotFingerprint.html#background) +- **Between-samples correlation plot**: plot comparing the similarity between all samples in terms of read coverage across genomic regions (see https://deeptools.readthedocs.io/en/latest/content/tools/plotCorrelation.html#background) +- **Per-replicate clustered heatmaps of peaks**: Clustered heatmap plots of IP read coverage (relative to control) around peaks called by MACS2; collection with one plot per replicate; the WF produces one more cluster per plot than there are samples in the replicate, but you can experiment with different cluster numbers by rerunning the tool with a different setting for *"Number of clusters to compute"* in the *"Clustering algorithm"* section near the bottom of the tool interface. +- **Clustered heatmap of peaks across all samples**: Clustered heatmap like above but as a single plot including all samples from all replicates; the WF produces one more cluster per plot than there are total samples across all replicates, but you can experiment with different cluster numbers by rerunning the tool with a different setting for *"Number of clusters to compute"* in the *"Clustering algorithm"* section near the bottom of the tool interface. +- **Peak regions called by MACS2**: collection of bed files describing the peak regions called by MACS2 and organized by replicate and IP condition +- **Positions of summits of MACS2-called peaks**: collection of bed files describing just the summits of the peaks called by MACS2, again organized by replicate and IP condition +- **Peaks per replicate**: collection of MACS2 treatment pileup output converted to bigWig format, organized by replicate and IP condition +- **Peaks averaged across replicates**: the Peaks per replicate output averaged across replicates with bigwigAverage from the deeptools suite; collection organized by IP condition + +## Related training material + +https://gxy.io/GTN:T00140 guides you through manual execution of all the key steps of this workflow with more detailed explanations. diff --git a/workflows/epigenetics/chipseq-pe-with-replicates-controls/chipseq-pe-with-replicates-controls-tests.yml b/workflows/epigenetics/chipseq-pe-with-replicates-controls/chipseq-pe-with-replicates-controls-tests.yml new file mode 100644 index 000000000..e315f5642 --- /dev/null +++ b/workflows/epigenetics/chipseq-pe-with-replicates-controls/chipseq-pe-with-replicates-controls-tests.yml @@ -0,0 +1,90 @@ +- doc: Test outline for ChIPseq-PE-with-replicates-controls workflow + job: + Sample sheet: + class: File + path: test-data/test_sample_sheet.tsv + filetype: tabular + Sequencing data: + class: Collection + collection_type: list:paired + elements: + - class: Collection + type: paired + identifier: SRR5204807 + elements: + - identifier: forward + class: File + location: https://github.com/nf-core/test-datasets/raw/refs/heads/chipseq/testdata/SRR5204807_Spt5-ChIP_IP1_SacCer_ChIP-Seq_ss100k_R1.fastq.gz + filetype: fastqsanger.gz + - identifier: reverse + class: File + location: https://github.com/nf-core/test-datasets/raw/refs/heads/chipseq/testdata/SRR5204807_Spt5-ChIP_IP1_SacCer_ChIP-Seq_ss100k_R2.fastq.gz + filetype: fastqsanger.gz + - class: Collection + type: paired + identifier: SRR5204808 + elements: + - identifier: forward + class: File + location: https://github.com/nf-core/test-datasets/raw/refs/heads/chipseq/testdata/SRR5204808_Spt5-ChIP_IP2_SacCer_ChIP-Seq_ss100k_R1.fastq.gz + filetype: fastqsanger.gz + - identifier: reverse + class: File + location: https://github.com/nf-core/test-datasets/raw/refs/heads/chipseq/testdata/SRR5204808_Spt5-ChIP_IP2_SacCer_ChIP-Seq_ss100k_R2.fastq.gz + filetype: fastqsanger.gz + - class: Collection + type: paired + identifier: SRR5204809 + elements: + - identifier: forward + class: File + location: https://github.com/nf-core/test-datasets/raw/refs/heads/chipseq/testdata/SRR5204809_Spt5-ChIP_Input1_SacCer_ChIP-Seq_ss100k_R1.fastq.gz + filetype: fastqsanger.gz + - identifier: reverse + class: File + location: https://github.com/nf-core/test-datasets/raw/refs/heads/chipseq/testdata/SRR5204809_Spt5-ChIP_Input1_SacCer_ChIP-Seq_ss100k_R2.fastq.gz + filetype: fastqsanger.gz + - class: Collection + type: paired + identifier: SRR5204810 + elements: + - identifier: forward + class: File + location: https://github.com/nf-core/test-datasets/raw/refs/heads/chipseq/testdata/SRR5204810_Spt5-ChIP_Input2_SacCer_ChIP-Seq_ss100k_R1.fastq.gz + filetype: fastqsanger.gz + - identifier: reverse + class: File + location: https://github.com/nf-core/test-datasets/raw/refs/heads/chipseq/testdata/SRR5204810_Spt5-ChIP_Input2_SacCer_ChIP-Seq_ss100k_R2.fastq.gz + filetype: fastqsanger.gz + Reference genome: "sacCer3" + Sequencing adapter - forward: null + Sequencing adapter - reverse: null + Effective genome size: 12000000 + Average size of sequenced fragments: 200 + outputs: + multiqc_stats: + asserts: + has_n_lines: + n: 5 + has_text_matching: + expression: "SRR5204807_Spt5_rep1\t163.0\t0.0\t0.0\t844.+" + macs2_report: + element_tests: + rep1: + elements: + SRR5204807_Spt5_rep1: + asserts: + - that: "has_text" + text: "# name = SRR5204807_Spt5_rep1" + - that: "has_text" + text: "# fragment size is determined as 163 bps" + - that: "has_text" + text: "# fragments after filtering in treatment: 86394" + mapping_stats: + element_tests: + SRR5204807_Spt5_rep1: + asserts: + - that: "has_text" + text: "3067 (3.14%) aligned concordantly 0 times" + - that: "has_text" + text: "80795 (82.60%) aligned concordantly exactly 1 time" diff --git a/workflows/epigenetics/chipseq-pe-with-replicates-controls/chipseq-pe-with-replicates-controls.ga b/workflows/epigenetics/chipseq-pe-with-replicates-controls/chipseq-pe-with-replicates-controls.ga new file mode 100644 index 000000000..8984ff77c --- /dev/null +++ b/workflows/epigenetics/chipseq-pe-with-replicates-controls/chipseq-pe-with-replicates-controls.ga @@ -0,0 +1,3692 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "A workflow for analyzing batches of ChIP-Seq samples with controls and replicates from paired-end sequenced reads to called peaks.", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "0000-0002-9464-6640", + "name": "Wolfgang Maier" + } + ], + "format-version": "0.1", + "license": "MIT", + "release": "0.1", + "name": "Quality control, mapping and peaks identification for ChIP-Seq replicates with controls", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "Four-column tabular dataset that describes the experimental design (see https://github.com/iwc-workflows/chipseq-pe-with-replicates-controls/blob/v0.1/README.md#input-datasets)", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Four-column tabular dataset that describes the experimental design (see https://github.com/iwc-workflows/chipseq-pe-with-replicates-controls/blob/v0.1/README.md#input-datasets)", + "name": "Sample sheet" + } + ], + "label": "Sample sheet", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 521.6343346071014 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "0b215137-17c5-4664-9146-29ab4f4aee98", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "List of pairs collection with outer IDs as specified in the sample sheet", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "List of pairs collection with outer IDs as specified in the sample sheet", + "name": "Sequencing data" + } + ], + "label": "Sequencing data", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 17.927373146289256, + "top": 776.0808460883304 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "5e044120-fe3e-4617-b2f9-ff2320eecb4e", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "Reference genome of organism of interest cached on the Galaxy server", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "Reference genome of organism of interest cached on the Galaxy server", + "name": "Reference genome" + } + ], + "label": "Reference genome", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 995.0372542525865, + "top": 727.5163925231486 + }, + "tool_id": null, + "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "804c67ca-926d-485a-9e53-67a7aba494f7", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ", + "name": "Sequencing adapter - forward" + } + ], + "label": "Sequencing adapter - forward", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 827.5595006162614, + "top": 1087.193451640713 + }, + "tool_id": null, + "tool_state": "{\"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "cac41a72-6029-4df9-96a3-50f34e412101", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "Please use: For R2: - For Nextera: CTGTCTCTTATACACATCTGACGCTGCCGACGA - For TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "Please use: For R2: - For Nextera: CTGTCTCTTATACACATCTGACGCTGCCGACGA - For TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", + "name": "Sequencing adapter - reverse" + } + ], + "label": "Sequencing adapter - reverse", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 826.5021242474772, + "top": 1187.8400692669659 + }, + "tool_id": null, + "tool_state": "{\"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "fbb01f6e-b7f4-42d1-8c58-76921b3553ab", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", + "name": "Effective genome size" + } + ], + "label": "Effective genome size", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 880.9767764745772, + "top": 1306.8754214151072 + }, + "tool_id": null, + "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "5bb3b3df-60ab-4ec7-88e4-476be547ffbf", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "The approx. size that the genome has been fragmented into before sequencing.\nIf unsure the default of 500 bases is a reasonable guess in most situations.", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "The approx. size that the genome has been fragmented into before sequencing.\nIf unsure the default of 500 bases is a reasonable guess in most situations.", + "name": "Average size of sequenced fragments" + } + ], + "label": "Average size of sequenced fragments", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 1075.7813318055119, + "top": 1786.2927008908207 + }, + "tool_id": null, + "tool_state": "{\"default\": 500, \"parameter_type\": \"integer\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "d584c246-bf0a-4149-b393-ae9f430b98e1", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1", + "errors": null, + "id": 7, + "input_connections": { + "infile": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": "Extended sample sheet", + "name": "Replace Text", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 264.85768736874513, + "top": 449.72044514833306 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \"^([^\\\\t]+)\\\\t([^\\\\t]+)\\\\t([^\\\\t]+)\\\\t([^\\\\t]+).*\", \"replace_pattern\": \"\\\\1\\\\t\\\\2\\\\t\\\\3\\\\t\\\\4\\\\t\\\\1_\\\\2_\\\\3\"}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", + "type": "tool", + "uuid": "c9904710-f573-41aa-a24a-aec174c44222", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", + "errors": null, + "id": 8, + "input_connections": { + "in_file": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": "Times each control is used", + "name": "Datamash", + "outputs": [ + { + "name": "out_file", + "type": "input" + } + ], + "position": { + "left": 731.9419907206449, + "top": 646.8294730238549 + }, + "post_job_actions": { + "HideDatasetActionout_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", + "tool_shed_repository": { + "changeset_revision": "4c07ddedc198", + "name": "datamash_ops", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"grouping\": \"4\", \"header_in\": false, \"header_out\": false, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": true, \"operations\": [{\"__index__\": 0, \"op_name\": \"count\", \"op_column\": \"1\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.8+galaxy0", + "type": "tool", + "uuid": "b1abe732-30dd-4375-8f24-0392fa1def4a", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 9, + "input_connections": { + "input_collection": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 273.8575119333104, + "top": 661.2031907256822 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "tabular" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.0.2", + "type": "tool", + "uuid": "d54d1d69-198c-46a5-bc1f-a9f4a9ae43c3", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 10, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 1322.255063702674, + "top": 1735.4406818912137 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"integer\", \"__current_case__\": 1, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": \"500\"}]}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.2.0", + "type": "tool", + "uuid": "a328900b-fa47-4d51-ab9a-8b86430b3507", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sort_header_tool/9.3+galaxy1", + "errors": null, + "id": 11, + "input_connections": { + "infile": { + "id": 7, + "output_name": "outfile" + } + }, + "inputs": [], + "label": "Sorted extended sample sheet", + "name": "Sort", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 588.2721934241824, + "top": 322.27694778246416 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sort_header_tool/9.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"header\": \"0\", \"ignore_case\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"sortkeys\": [{\"__index__\": 0, \"column\": \"3\", \"order\": \"\", \"style\": \"\"}, {\"__index__\": 1, \"column\": \"1\", \"order\": \"\", \"style\": \"V\"}], \"unique\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", + "type": "tool", + "uuid": "88b7a534-a109-40c1-9c92-16f7ba0e7c15", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 12, + "input_connections": { + "input": { + "id": 7, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 545.1399341423057, + "top": 781.7016976815331 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c5\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "ae6dd67a-7374-4438-b997-d5baae7b21ad", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 13, + "input_connections": { + "input": { + "id": 7, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1306.8618195584188, + "top": 642.9983147512831 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c5,c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "6e3bd74e-c68f-4e85-883f-ffab74305698", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "join1", + "errors": null, + "id": 14, + "input_connections": { + "input1": { + "id": 9, + "output_name": "output" + }, + "input2": { + "id": 8, + "output_name": "out_file" + } + }, + "inputs": [], + "label": null, + "name": "Join two Datasets", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 966.0878668920052, + "top": 474.40108294302513 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "join1", + "tool_state": "{\"field1\": \"1\", \"field2\": \"1\", \"fill_empty_columns\": {\"fill_empty_columns_switch\": \"no_fill\", \"__current_case__\": 0}, \"header\": \"\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"input2\": {\"__class__\": \"ConnectedValue\"}, \"partial\": \"\", \"unmatched\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.1.3", + "type": "tool", + "uuid": "28965772-35a2-4ebb-abed-15d6084ec45b", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/calculate_numeric_param/calculate_numeric_param/0.1.0", + "errors": null, + "id": 15, + "input_connections": { + "components_0|param_type|component_value": { + "id": 5, + "output_name": "output" + }, + "components_1|param_type|component_value": { + "id": 10, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Calculate numeric parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 1349.9881681976492, + "top": 1395.0253368234305 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/calculate_numeric_param/calculate_numeric_param/0.1.0", + "tool_shed_repository": { + "changeset_revision": "0e586762f97b", + "name": "calculate_numeric_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}, \"arith\": \"/\"}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}, \"arith\": \"\"}], \"output_type\": \"integer\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "7370c82b-7b1a-46cd-a746-dcc6b07b2609", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 16, + "input_connections": { + "input": { + "id": 11, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Filter", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 840.8899683615371, + "top": 320.8931025647788 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c4!='.' and c4 !='-'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "d2babe63-ac01-430f-812d-36f72c278360", + "when": null, + "workflow_outputs": [] + }, + "17": { + "annotation": "", + "content_id": "__RELABEL_FROM_FILE__", + "errors": null, + "id": 17, + "input_connections": { + "how|labels": { + "id": 12, + "output_name": "out_file1" + }, + "input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Relabel identifiers", + "name": "how" + } + ], + "label": null, + "name": "Relabel identifiers", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 789.3249288889377, + "top": 881.9540173239981 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__RELABEL_FROM_FILE__", + "tool_state": "{\"how\": {\"how_select\": \"tabular\", \"__current_case__\": 1, \"labels\": {\"__class__\": \"ConnectedValue\"}, \"strict\": true}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "0b02c063-17cd-48f7-93fb-77a8ed185ef7", + "when": null, + "workflow_outputs": [] + }, + "18": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 18, + "input_connections": { + "input": { + "id": 14, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1522.4113115404125, + "top": 504.3788813002956 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "819b3b0c-ebe6-4f87-84a5-78e31a157203", + "when": null, + "workflow_outputs": [] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/calculate_numeric_param/calculate_numeric_param/0.1.0", + "errors": null, + "id": 19, + "input_connections": { + "components_0|param_type|component_value": { + "id": 15, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Calculate numeric parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 1585.0225742456657, + "top": 1373.396403751527 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/calculate_numeric_param/calculate_numeric_param/0.1.0", + "tool_shed_repository": { + "changeset_revision": "0e586762f97b", + "name": "calculate_numeric_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}, \"arith\": \"/\"}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 0, \"component_value\": \"100000\"}, \"arith\": \"\"}], \"output_type\": \"integer\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d52a247f-21aa-4ac1-b7a5-5b2e6aa4ee4a", + "when": null, + "workflow_outputs": [] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "errors": null, + "id": 20, + "input_connections": { + "components_0|param_type|component_value": { + "id": 15, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Compose text parameter value", + "outputs": [ + { + "name": "out1", + "type": "expression.json" + } + ], + "position": { + "left": 1618.186938289251, + "top": 1562.2890859128165 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_shed_repository": { + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "2e881981-7e67-427a-b63f-c87694dd6d0b", + "when": null, + "workflow_outputs": [] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "errors": null, + "id": 21, + "input_connections": { + "input": { + "id": 16, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 980.3961008036761, + "top": 125.86588579144791 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "tool_shed_repository": { + "changeset_revision": "023f0a3760b3", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"exp\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"yes\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.1", + "type": "tool", + "uuid": "67f20a9e-f5f5-4b89-bc9f-57f8cb6d8143", + "when": null, + "workflow_outputs": [] + }, + "22": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 22, + "input_connections": { + "input": { + "id": 16, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "IDs to replicates association of IPed samples", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1242.1656556688915, + "top": 155.60868928316074 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "0dd5ab36-d43d-40a3-a04f-2c9f5f1cb81d", + "when": null, + "workflow_outputs": [] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy1", + "errors": null, + "id": 23, + "input_connections": { + "single_paired|adapter_trimming_options|adapter_sequence1": { + "id": 3, + "output_name": "output" + }, + "single_paired|adapter_trimming_options|adapter_sequence2": { + "id": 4, + "output_name": "output" + }, + "single_paired|paired_input": { + "id": 17, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool fastp", + "name": "single_paired" + } + ], + "label": null, + "name": "fastp", + "outputs": [ + { + "name": "output_paired_coll", + "type": "input" + }, + { + "name": "report_html", + "type": "html" + }, + { + "name": "report_json", + "type": "json" + } + ], + "position": { + "left": 1104.3618353795332, + "top": 983.9513356433255 + }, + "post_job_actions": { + "HideDatasetActionreport_json": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report_json" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy1", + "tool_shed_repository": { + "changeset_revision": "d60c3f704da0", + "name": "fastp", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter_options\": {\"quality_filtering_options\": {\"disable_quality_filtering\": false, \"qualified_quality_phred\": \"30\", \"unqualified_percent_limit\": null, \"n_base_limit\": null}, \"length_filtering_options\": {\"disable_length_filtering\": false, \"length_required\": null, \"length_limit\": null}, \"low_complexity_filter\": {\"enable_low_complexity_filter\": false, \"complexity_threshold\": null}}, \"output_options\": {\"report_html\": true, \"report_json\": true}, \"overrepresented_sequence_analysis\": {\"overrepresentation_analysis\": false, \"overrepresentation_sampling\": null}, \"read_mod_options\": {\"polyg_tail_trimming\": {\"trimming_select\": \"\", \"__current_case__\": 1, \"poly_g_min_len\": null}, \"polyx_tail_trimming\": {\"polyx_trimming_select\": \"\", \"__current_case__\": 1}, \"umi_processing\": {\"umi\": false, \"umi_loc\": null, \"umi_len\": null, \"umi_prefix\": null}, \"cutting_by_quality_options\": {\"cut_by_quality5\": false, \"cut_by_quality3\": true, \"cut_window_size\": null, \"cut_mean_quality\": \"30\"}, \"base_correction_options\": {\"correction\": false}}, \"single_paired\": {\"single_paired_selector\": \"paired_collection\", \"__current_case__\": 2, \"paired_input\": {\"__class__\": \"ConnectedValue\"}, \"adapter_trimming_options\": {\"disable_adapter_trimming\": false, \"adapter_sequence1\": {\"__class__\": \"ConnectedValue\"}, \"adapter_sequence2\": {\"__class__\": \"ConnectedValue\"}, \"detect_adapter_for_pe\": false}, \"global_trimming_options\": {\"trim_front1\": null, \"trim_tail1\": null, \"trim_front2\": null, \"trim_tail2\": null}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.23.4+galaxy1", + "type": "tool", + "uuid": "37d83004-f627-4b68-808c-3b2bcb6f70ac", + "when": null, + "workflow_outputs": [ + { + "label": "report_html", + "output_name": "report_html", + "uuid": "58dd6572-c592-41c8-af6c-7ea445391426" + }, + { + "label": "output_paired_coll", + "output_name": "output_paired_coll", + "uuid": "590f893b-6188-4adc-9513-33ac2cabacb0" + } + ] + }, + "24": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2", + "errors": null, + "id": 24, + "input_connections": { + "split_parms|input": { + "id": 18, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Split file", + "name": "split_parms" + } + ], + "label": null, + "name": "Split file", + "outputs": [ + { + "name": "list_output_tab", + "type": "input" + } + ], + "position": { + "left": 2317.6344412377093, + "top": 866.0422755242138 + }, + "post_job_actions": { + "HideDatasetActionlist_output_tab": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "list_output_tab" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2", + "tool_shed_repository": { + "changeset_revision": "2dae863c8f42", + "name": "split_file_to_collection", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"split_parms\": {\"select_ftype\": \"tabular\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}, \"top\": \"0\", \"split_by\": {\"select_split_by\": \"row\", \"__current_case__\": 1, \"select_mode\": {\"mode\": \"chunk\", \"__current_case__\": 0, \"chunksize\": \"1\"}, \"newfilenames\": \"repeat_times\", \"select_allocate\": {\"allocate\": \"byrow\", \"__current_case__\": 2}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.5.2", + "type": "tool", + "uuid": "29a05f37-6cea-475a-af20-a97797efc29c", + "when": null, + "workflow_outputs": [] + }, + "25": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 25, + "input_connections": { + "input_param_type|input_param": { + "id": 19, + "output_name": "integer_param" + }, + "input_param_type|mappings_0|to": { + "id": 20, + "output_name": "out1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_integer", + "type": "expression.json" + } + ], + "position": { + "left": 1844.569771108506, + "top": 1410.8865544094929 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_integer": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_integer" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"integer\", \"__current_case__\": 1, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": {\"__class__\": \"ConnectedValue\"}}]}, \"output_param_type\": \"integer\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"100000\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.2.0", + "type": "tool", + "uuid": "4747aad7-cd27-4690-b577-c62df03a30c2", + "when": null, + "workflow_outputs": [] + }, + "26": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 26, + "input_connections": { + "input": { + "id": 21, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Extended sample names mapped to conditions", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1241.3099576196778, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c5,c2,c6\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "330c6377-e8ab-4bf0-9b5e-8e7881d7326f", + "when": null, + "workflow_outputs": [] + }, + "27": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 27, + "input_connections": { + "input": { + "id": 21, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "IDs to replicates associaction of matching controls", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1240.51048330279, + "top": 296.7926761387355 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c4,c3,c6\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "1b79e171-ecc8-4202-91ed-24d68c3783a6", + "when": null, + "workflow_outputs": [] + }, + "28": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 28, + "input_connections": { + "input": { + "id": 22, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "IDs of IPed samples", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1795.0548103169126, + "top": 341.7169400274215 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "4709c8ea-3ca7-4613-9017-df4c50e72eb3", + "when": null, + "workflow_outputs": [] + }, + "29": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1", + "errors": null, + "id": 29, + "input_connections": { + "library|input_1": { + "id": 23, + "output_name": "output_paired_coll" + }, + "reference_genome|index": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Bowtie2", + "name": "library" + }, + { + "description": "runtime parameter for tool Bowtie2", + "name": "reference_genome" + } + ], + "label": null, + "name": "Bowtie2", + "outputs": [ + { + "name": "output", + "type": "bam" + }, + { + "name": "mapping_stats", + "type": "txt" + } + ], + "position": { + "left": 1376.398809923191, + "top": 954.5764548042524 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "d5ceb9f3c25b", + "name": "bowtie2", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"no_presets\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"no\", \"__current_case__\": 1}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"set\", \"__current_case__\": 1, \"read_group_id_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"read_group_sm_conditional\": {\"do_auto_name\": false, \"__current_case__\": 1, \"SM\": \"\"}, \"PL\": \"ILLUMINA\", \"read_group_lb_conditional\": {\"do_auto_name\": false, \"__current_case__\": 1, \"LB\": null}, \"CN\": null, \"DS\": null, \"DT\": null, \"FO\": null, \"KS\": null, \"PG\": null, \"PI\": null, \"PU\": null}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.5.3+galaxy1", + "type": "tool", + "uuid": "98ebcaae-3aa7-4b3c-8274-cb05b9286a58", + "when": null, + "workflow_outputs": [ + { + "label": "mapping_stats", + "output_name": "mapping_stats", + "uuid": "42dbd7d5-acfb-4432-abc9-f4341ded939a" + } + ] + }, + "30": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 30, + "input_connections": { + "input1": { + "id": 24, + "output_name": "list_output_tab" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 2558.35187957346, + "top": 872.8096430004058 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "c98a9b68-5a84-4162-8699-97daad6b04e5", + "when": null, + "workflow_outputs": [] + }, + "31": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1", + "errors": null, + "id": 31, + "input_connections": { + "infile": { + "id": 26, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Replace Text", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 1789.4066406548234, + "top": 6.7480809547996365 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \"(.+)\\\\t(.+)\\\\t(.+)\", \"replace_pattern\": \"\\\\1\\\\t\\\\2_\\\\3\"}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", + "type": "tool", + "uuid": "44f85b6d-e4c4-4e6b-a4cf-c6c00c5d3c65", + "when": null, + "workflow_outputs": [] + }, + "32": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1", + "errors": null, + "id": 32, + "input_connections": { + "infile": { + "id": 27, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Replace Text", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 2703.0942563792655, + "top": 1180.3701452209295 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \"(.+)\\\\t(.+)\\\\t(.+)\", \"replace_pattern\": \"\\\\1_\\\\3\\\\t\\\\2\"}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", + "type": "tool", + "uuid": "2915992b-4cef-4f70-a978-92450fcb3036", + "when": null, + "workflow_outputs": [] + }, + "33": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", + "errors": null, + "id": 33, + "input_connections": { + "input": { + "id": 29, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Samtools view", + "outputs": [ + { + "name": "outputsam", + "type": "input" + } + ], + "position": { + "left": 1632.101587102184, + "top": 932.9832386429648 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", + "tool_shed_repository": { + "changeset_revision": "32dc5f781059", + "name": "samtools_view", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"cond_expr\": {\"select_expr\": \"no\", \"__current_case__\": 0}, \"quality\": \"30\", \"library\": null, \"cigarcons\": null, \"inclusive_filter\": [\"2\"], \"exclusive_filter\": [\"4\", \"8\"], \"exclusive_filter_all\": null, \"tag\": null, \"qname_file\": {\"__class__\": \"RuntimeValue\"}}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"fraction\", \"__current_case__\": 0, \"factor\": \"1.0\", \"seed\": null}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": false, \"adv_output\": {\"readtags\": [], \"collapsecigar\": false}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.20+galaxy3", + "type": "tool", + "uuid": "bbe08c3f-bad6-46aa-87f8-8e0382a36c69", + "when": null, + "workflow_outputs": [ + { + "label": "outputsam", + "output_name": "outputsam", + "uuid": "585b9a5c-dcbd-45b7-88a6-11b689989c90" + } + ] + }, + "34": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 34, + "input_connections": { + "input": { + "id": 32, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 3279.8658049633555, + "top": 1343.3081517001117 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "79e787de-eb19-4596-b08e-25c611925b1c", + "when": null, + "workflow_outputs": [] + }, + "35": { + "annotation": "", + "content_id": "__RELABEL_FROM_FILE__", + "errors": null, + "id": 35, + "input_connections": { + "how|labels": { + "id": 13, + "output_name": "out_file1" + }, + "input": { + "id": 33, + "output_name": "outputsam" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Relabel identifiers", + "name": "how" + } + ], + "label": null, + "name": "Relabel identifiers", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 1872.5432264181763, + "top": 835.5329084162294 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__RELABEL_FROM_FILE__", + "tool_state": "{\"how\": {\"how_select\": \"tabular\", \"__current_case__\": 1, \"labels\": {\"__class__\": \"ConnectedValue\"}, \"strict\": true}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "f6df4fc9-49c4-46ca-ba57-8c0657037c5e", + "when": null, + "workflow_outputs": [] + }, + "36": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_plot_fingerprint/deeptools_plot_fingerprint/3.5.4+galaxy0", + "errors": null, + "id": 36, + "input_connections": { + "advancedOpt|binSize": { + "id": 10, + "output_name": "integer_param" + }, + "advancedOpt|numberOfSamples": { + "id": 25, + "output_name": "output_param_integer" + }, + "multibam_conditional|bamfiles": { + "id": 33, + "output_name": "outputsam" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool plotFingerprint", + "name": "advancedOpt" + }, + { + "description": "runtime parameter for tool plotFingerprint", + "name": "advancedOpt" + }, + { + "description": "runtime parameter for tool plotFingerprint", + "name": "advancedOpt" + }, + { + "description": "runtime parameter for tool plotFingerprint", + "name": "multibam_conditional" + } + ], + "label": null, + "name": "plotFingerprint", + "outputs": [ + { + "name": "outFileName", + "type": "png" + } + ], + "position": { + "left": 2285.3674447155677, + "top": 1395.2896919166708 + }, + "post_job_actions": { + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "Sample Fingerprints" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + }, + "TagDatasetActionoutFileName": { + "action_arguments": { + "tags": "\ud83d\udd0d" + }, + "action_type": "TagDatasetAction", + "output_name": "outFileName" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_plot_fingerprint/deeptools_plot_fingerprint/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "4ed32329e0ed", + "name": "deeptools_plot_fingerprint", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"numberOfSamples\": {\"__class__\": \"ConnectedValue\"}, \"doExtendCustom\": {\"doExtend\": \"no\", \"__current_case__\": 0}, \"ignoreDuplicates\": false, \"centerReads\": false, \"minMappingQuality\": \"1\", \"samFlagInclude\": null, \"samFlagExclude\": null, \"minFragmentLength\": \"0\", \"maxFragmentLength\": \"0\", \"skipZeros\": true, \"plotTitle\": \"\", \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"custom_sample_labels_conditional\": {\"custom_labels_select\": \"No\", \"__current_case__\": 0}, \"multibam_conditional\": {\"orderMatters\": \"No\", \"__current_case__\": 0, \"bamfiles\": {\"__class__\": \"ConnectedValue\"}}, \"output\": {\"showOutputSettings\": \"no\", \"__current_case__\": 0}, \"region\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "0794697e-3653-4fdb-9362-7aafcee0a7c5", + "when": null, + "workflow_outputs": [ + { + "label": "fingerprints", + "output_name": "outFileName", + "uuid": "90ec9b14-a426-4cde-8fd4-9eda8f546c6c" + } + ] + }, + "37": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_multi_bam_summary/deeptools_multi_bam_summary/3.5.4+galaxy0", + "errors": null, + "id": 37, + "input_connections": { + "mode|binSize": { + "id": 10, + "output_name": "integer_param" + }, + "multibam_conditional|bamfiles": { + "id": 33, + "output_name": "outputsam" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool multiBamSummary", + "name": "mode" + }, + { + "description": "runtime parameter for tool multiBamSummary", + "name": "multibam_conditional" + } + ], + "label": null, + "name": "multiBamSummary", + "outputs": [ + { + "name": "outFile", + "type": "deeptools_coverage_matrix" + } + ], + "position": { + "left": 2292.240633135638, + "top": 1749.5475849533962 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_multi_bam_summary/deeptools_multi_bam_summary/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "01fb6a7654e6", + "name": "deeptools_multi_bam_summary", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"no\", \"__current_case__\": 0}, \"custom_sample_labels_conditional\": {\"custom_labels_select\": \"No\", \"__current_case__\": 0}, \"mode\": {\"modeOpt\": \"bins\", \"__current_case__\": 0, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"distanceBetweenBins\": \"200\"}, \"multibam_conditional\": {\"orderMatters\": \"No\", \"__current_case__\": 0, \"bamfiles\": {\"__class__\": \"ConnectedValue\"}}, \"outRawCounts\": false, \"region\": \"\", \"scalingFactors\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "b99feccd-72a9-4726-9537-e733621c16d9", + "when": null, + "workflow_outputs": [] + }, + "38": { + "annotation": "", + "content_id": "__FILTER_FROM_FILE__", + "errors": null, + "id": 38, + "input_connections": { + "how|filter_source": { + "id": 28, + "output_name": "out_file1" + }, + "input": { + "id": 35, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Filter collection", + "name": "how" + } + ], + "label": null, + "name": "Filter collection", + "outputs": [ + { + "name": "output_filtered", + "type": "input" + }, + { + "name": "output_discarded", + "type": "input" + } + ], + "position": { + "left": 2313.605995441952, + "top": 587.9874937180731 + }, + "post_job_actions": { + "HideDatasetActionoutput_discarded": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_discarded" + }, + "HideDatasetActionoutput_filtered": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_filtered" + } + }, + "tool_id": "__FILTER_FROM_FILE__", + "tool_state": "{\"how\": {\"how_filter\": \"remove_if_absent\", \"__current_case__\": 0, \"filter_source\": {\"__class__\": \"ConnectedValue\"}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "f234484d-9b05-418f-b9dd-7da30887a88d", + "when": null, + "workflow_outputs": [] + }, + "39": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_plot_correlation/deeptools_plot_correlation/3.5.4+galaxy0", + "errors": null, + "id": 39, + "input_connections": { + "corData": { + "id": 37, + "output_name": "outFile" + } + }, + "inputs": [], + "label": null, + "name": "plotCorrelation", + "outputs": [ + { + "name": "outFileName", + "type": "png" + } + ], + "position": { + "left": 2544.385975396104, + "top": 1757.0696149631171 + }, + "post_job_actions": { + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "Between-samples correlation plot" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + }, + "TagDatasetActionoutFileName": { + "action_arguments": { + "tags": "\ud83d\udd0d" + }, + "action_type": "TagDatasetAction", + "output_name": "outFileName" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_plot_correlation/deeptools_plot_correlation/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bad3ca889618", + "name": "deeptools_plot_correlation", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"corData\": {\"__class__\": \"ConnectedValue\"}, \"corMethod\": \"spearman\", \"outFileCorMatrix\": false, \"outFileFormat\": \"png\", \"plotting_type\": {\"whatToPlot\": \"heatmap\", \"__current_case__\": 0, \"zMin\": \"\", \"zMax\": \"\", \"colorMap\": \"RdYlBu\", \"plotTitle\": \"\", \"plotNumbers\": true, \"plotHeight\": \"9.5\", \"plotWidth\": \"11.0\"}, \"removeOutliers\": false, \"skipZeros\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "c2012389-0703-4c85-afe4-72a2a68308b7", + "when": null, + "workflow_outputs": [ + { + "label": "sample_correlation", + "output_name": "outFileName", + "uuid": "7285d4e5-803c-460d-a488-ccc1d62fe9b9" + } + ] + }, + "40": { + "annotation": "", + "content_id": "__SORTLIST__", + "errors": null, + "id": 40, + "input_connections": { + "input": { + "id": 38, + "output_name": "output_filtered" + }, + "sort_type|sort_file": { + "id": 28, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Sort collection", + "name": "sort_type" + } + ], + "label": null, + "name": "Sort collection", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 2782.0268972958656, + "top": 471.76721888258373 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__SORTLIST__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"sort_type\": {\"sort_type\": \"file\", \"__current_case__\": 2, \"sort_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "84a991d9-791b-41df-8a1e-c135f8e37a2c", + "when": null, + "workflow_outputs": [] + }, + "41": { + "annotation": "", + "content_id": "__DUPLICATE_FILE_TO_COLLECTION__", + "errors": null, + "id": 41, + "input_connections": { + "input": { + "id": 38, + "output_name": "output_discarded" + }, + "number": { + "id": 30, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Duplicate file to collection", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 2953.9640182151957, + "top": 832.009632831452 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__DUPLICATE_FILE_TO_COLLECTION__", + "tool_state": "{\"element_identifier\": \"_\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"number\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "f75440bf-5cb7-4c6e-bc1a-fb2edbd1341e", + "when": null, + "workflow_outputs": [] + }, + "42": { + "annotation": "", + "content_id": "__TAG_FROM_FILE__", + "errors": null, + "id": 42, + "input_connections": { + "input": { + "id": 40, + "output_name": "output" + }, + "tags": { + "id": 22, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Tag elements", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 3241.5932168576664, + "top": 355.58981740841716 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__TAG_FROM_FILE__", + "tool_state": "{\"how\": \"add\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"tags\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "28297280-7945-4795-a227-34ca2f72b9a8", + "when": null, + "workflow_outputs": [] + }, + "43": { + "annotation": "", + "content_id": "__APPLY_RULES__", + "errors": null, + "id": 43, + "input_connections": { + "input": { + "id": 41, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Apply rules", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 3279.553432805206, + "top": 1153.628050156597 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__APPLY_RULES__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"rules\": {\"mapping\": [{\"columns\": [4], \"editing\": false, \"type\": \"list_identifiers\"}], \"rules\": [{\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier0\", \"warn\": null}, {\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier1\", \"warn\": null}, {\"error\": null, \"start\": 1, \"type\": \"add_column_rownum\", \"warn\": null}, {\"error\": null, \"expression\": \"(.+)\", \"group_count\": null, \"replacement\": \"_\\\\1\", \"target_column\": 2, \"type\": \"add_column_regex\", \"warn\": null}, {\"error\": null, \"target_column_0\": 0, \"target_column_1\": 3, \"type\": \"add_column_concatenate\", \"warn\": null}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0", + "type": "tool", + "uuid": "0b860ea0-f722-4a84-a5dc-2e5307ffae4f", + "when": null, + "workflow_outputs": [] + }, + "44": { + "annotation": "", + "content_id": "__RELABEL_FROM_FILE__", + "errors": null, + "id": 44, + "input_connections": { + "how|labels": { + "id": 12, + "output_name": "out_file1" + }, + "input": { + "id": 42, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Relabel identifiers", + "name": "how" + } + ], + "label": null, + "name": "Relabel identifiers", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 3490.1173128420783, + "top": 246.44928205248672 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__RELABEL_FROM_FILE__", + "tool_state": "{\"how\": {\"how_select\": \"tabular\", \"__current_case__\": 1, \"labels\": {\"__class__\": \"ConnectedValue\"}, \"strict\": false}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "c3fa7964-d4db-461e-8b88-b93b57fe3cc1", + "when": null, + "workflow_outputs": [] + }, + "45": { + "annotation": "", + "content_id": "__SORTLIST__", + "errors": null, + "id": 45, + "input_connections": { + "input": { + "id": 43, + "output_name": "output" + }, + "sort_type|sort_file": { + "id": 34, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Sort collection", + "name": "sort_type" + } + ], + "label": null, + "name": "Sort collection", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 3724.324188083806, + "top": 1415.7620399621792 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__SORTLIST__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"sort_type\": {\"sort_type\": \"file\", \"__current_case__\": 2, \"sort_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "3bc49cc6-412c-4c51-ba89-b6a7257fc65d", + "when": null, + "workflow_outputs": [] + }, + "46": { + "annotation": "", + "content_id": "__APPLY_RULES__", + "errors": null, + "id": 46, + "input_connections": { + "input": { + "id": 44, + "output_name": "output" + } + }, + "inputs": [], + "label": "Per-replicate list of IPed sample data", + "name": "Apply rules", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 3894.0699731774043, + "top": 669.1884364276625 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__APPLY_RULES__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"rules\": {\"mapping\": [{\"columns\": [1, 0], \"editing\": false, \"type\": \"list_identifiers\"}], \"rules\": [{\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier0\", \"warn\": null}, {\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"tags\", \"warn\": null}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0", + "type": "tool", + "uuid": "62ce7d38-d7f1-41f3-aae3-04f9e21d6a8f", + "when": null, + "workflow_outputs": [] + }, + "47": { + "annotation": "", + "content_id": "__TAG_FROM_FILE__", + "errors": null, + "id": 47, + "input_connections": { + "input": { + "id": 45, + "output_name": "output" + }, + "tags": { + "id": 32, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Tag elements", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 3589.9859596505003, + "top": 1621.8916401244505 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__TAG_FROM_FILE__", + "tool_state": "{\"how\": \"add\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"tags\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "f83d3c2a-c857-4d18-937d-0111648fc08a", + "when": null, + "workflow_outputs": [] + }, + "48": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 48, + "input_connections": { + "input_collection": { + "id": 46, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 4230.8425725597335, + "top": 676.2845382917118 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.0.2", + "type": "tool", + "uuid": "d08d7a05-1578-4903-b986-be9eddf2e501", + "when": null, + "workflow_outputs": [] + }, + "49": { + "annotation": "", + "content_id": "__APPLY_RULES__", + "errors": null, + "id": 49, + "input_connections": { + "input": { + "id": 47, + "output_name": "output" + } + }, + "inputs": [], + "label": "Per-replicate list of control samples", + "name": "Apply rules", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 4008.752690864601, + "top": 1656.9030533546313 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__APPLY_RULES__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"rules\": {\"mapping\": [{\"columns\": [1, 0], \"editing\": false, \"type\": \"list_identifiers\"}], \"rules\": [{\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier0\", \"warn\": null}, {\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"tags\", \"warn\": null}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0", + "type": "tool", + "uuid": "ee8cb05d-3642-4109-aec0-5f002070cf3c", + "when": null, + "workflow_outputs": [] + }, + "50": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 50, + "input_connections": { + "input1": { + "id": 48, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 4551.65577744577, + "top": 626.0141158113014 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": false, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "a7b1293a-c57d-4d33-a5ab-dbc8b1cd6a62", + "when": null, + "workflow_outputs": [] + }, + "51": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", + "errors": null, + "id": 51, + "input_connections": { + "control|c_multiple|input_control_file": { + "id": 49, + "output_name": "output" + }, + "effective_genome_size_options|gsize": { + "id": 5, + "output_name": "output" + }, + "treatment|input_treatment_file": { + "id": 46, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool MACS2 callpeak", + "name": "effective_genome_size_options" + }, + { + "description": "runtime parameter for tool MACS2 callpeak", + "name": "treatment" + } + ], + "label": "Call Peaks with MACS2", + "name": "MACS2 callpeak", + "outputs": [ + { + "name": "output_tabular", + "type": "tabular" + }, + { + "name": "output_narrowpeaks", + "type": "bed" + }, + { + "name": "output_summits", + "type": "bed" + }, + { + "name": "output_treat_pileup", + "type": "bedgraph" + }, + { + "name": "output_control_lambda", + "type": "bedgraph" + } + ], + "position": { + "left": 4464.50389169328, + "top": 1163.6764259639986 + }, + "post_job_actions": { + "HideDatasetActionoutput_control_lambda": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_control_lambda" + }, + "HideDatasetActionoutput_extra_files": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_extra_files" + }, + "HideDatasetActionoutput_treat_pileup": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_treat_pileup" + }, + "RenameDatasetActionoutput_control_lambda": { + "action_arguments": { + "newname": "MACS2 control coverage" + }, + "action_type": "RenameDatasetAction", + "output_name": "output_control_lambda" + }, + "RenameDatasetActionoutput_narrowpeaks": { + "action_arguments": { + "newname": "Peak regions called by MACS2" + }, + "action_type": "RenameDatasetAction", + "output_name": "output_narrowpeaks" + }, + "RenameDatasetActionoutput_summits": { + "action_arguments": { + "newname": "Positions of summits of MACS2-called peaks" + }, + "action_type": "RenameDatasetAction", + "output_name": "output_summits" + }, + "RenameDatasetActionoutput_treat_pileup": { + "action_arguments": { + "newname": "MACS2 treatment coverage" + }, + "action_type": "RenameDatasetAction", + "output_name": "output_treat_pileup" + }, + "TagDatasetActionoutput_narrowpeaks": { + "action_arguments": { + "tags": "\ud83c\udf1f" + }, + "action_type": "TagDatasetAction", + "output_name": "output_narrowpeaks" + }, + "TagDatasetActionoutput_summits": { + "action_arguments": { + "tags": "\ud83c\udf1f" + }, + "action_type": "TagDatasetAction", + "output_name": "output_summits" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "86e2413cf3f8", + "name": "macs2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": true, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"Yes\", \"__current_case__\": 0, \"c_multiple\": {\"c_multi_select\": \"No\", \"__current_case__\": 0, \"input_control_file\": {\"__class__\": \"ConnectedValue\"}}}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAMPE\", \"nomodel_type\": {\"nomodel_type_selector\": \"create_model\", \"__current_case__\": 0, \"mfold_lower\": \"5\", \"mfold_upper\": \"50\", \"band_width\": \"300\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.2.9.1+galaxy0", + "type": "tool", + "uuid": "06ca906e-c512-4376-9ffc-8eb2b5774af1", + "when": null, + "workflow_outputs": [ + { + "label": "peak_summits", + "output_name": "output_summits", + "uuid": "a10f9de1-eafd-4d68-bf8f-a331d111f272" + }, + { + "label": "peak_regions", + "output_name": "output_narrowpeaks", + "uuid": "feac3ce1-00ff-4065-9279-eea3ddc58191" + } + ] + }, + "52": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_compare/deeptools_bam_compare/3.5.4+galaxy0", + "errors": null, + "id": 52, + "input_connections": { + "bamFile1": { + "id": 46, + "output_name": "output" + }, + "bamFile2": { + "id": 49, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool bamCompare", + "name": "advancedOpt" + } + ], + "label": null, + "name": "bamCompare", + "outputs": [ + { + "name": "outFileName", + "type": "bigwig" + } + ], + "position": { + "left": 4647.906234356017, + "top": 1970.5531892679364 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_compare/deeptools_bam_compare/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "c929a006727f", + "name": "deeptools_bam_compare", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"smoothLength\": null, \"doExtendCustom\": {\"doExtend\": \"no\", \"__current_case__\": 0}, \"ignoreDuplicates\": false, \"centerReads\": false, \"minMappingQuality\": \"1\", \"samFlagInclude\": null, \"samFlagExclude\": null, \"minFragmentLength\": \"0\", \"maxFragmentLength\": \"0\", \"skipNAs\": false, \"skipZeroOverZero\": \"--skipZeroOverZero\", \"ignoreForNormalization\": \"\", \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"bamFile1\": {\"__class__\": \"ConnectedValue\"}, \"bamFile2\": {\"__class__\": \"ConnectedValue\"}, \"binSize\": \"50\", \"comparison\": {\"type\": \"log2\", \"__current_case__\": 0, \"pseudocount\": \"1 1\"}, \"exactScaling\": false, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"scaling\": {\"method\": \"readCount\", \"__current_case__\": 1}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "3f1782e6-2fa5-44fa-9492-5754df8db988", + "when": null, + "workflow_outputs": [] + }, + "53": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 53, + "input_connections": { + "input1": { + "id": 50, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 4961.0048130551595, + "top": 619.5695622494998 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "8eeff7e3-dab2-40fd-9d2a-45ed37e65dc4", + "when": null, + "workflow_outputs": [] + }, + "54": { + "annotation": "", + "content_id": "__FLATTEN__", + "errors": null, + "id": 54, + "input_connections": { + "input": { + "id": 51, + "output_name": "output_tabular" + } + }, + "inputs": [], + "label": null, + "name": "Flatten collection", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 4812.33347874683, + "top": 987.3303206340295 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__FLATTEN__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"join_identifier\": \"_\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "e28b32fa-bfff-4317-a852-c43c76c29778", + "when": null, + "workflow_outputs": [] + }, + "55": { + "annotation": "summary of MACS2", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1", + "errors": null, + "id": 55, + "input_connections": { + "infile": { + "id": 51, + "output_name": "output_tabular" + } + }, + "inputs": [], + "label": "summary of MACS2", + "name": "Search in textfiles", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 4809.930234624945, + "top": 1115.5899113520873 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "txt" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "MACS2 report" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-P\", \"url_paste\": \"^#\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", + "type": "tool", + "uuid": "95832fa1-e96e-4867-8162-d1e39cb1dc46", + "when": null, + "workflow_outputs": [ + { + "label": "macs2_report", + "output_name": "output", + "uuid": "dc081d2e-e155-4ff3-98c5-45ee266a5e34" + } + ] + }, + "56": { + "annotation": "", + "content_id": "__APPLY_RULES__", + "errors": null, + "id": 56, + "input_connections": { + "input": { + "id": 51, + "output_name": "output_narrowpeaks" + } + }, + "inputs": [], + "label": null, + "name": "Apply rules", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 4697.796238588279, + "top": 1590.6968405266741 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__APPLY_RULES__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"rules\": {\"mapping\": [{\"columns\": [1], \"editing\": false, \"type\": \"list_identifiers\"}], \"rules\": [{\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier0\", \"warn\": null}, {\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier1\", \"warn\": null}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0", + "type": "tool", + "uuid": "53d75717-943d-4273-89ad-875890803997", + "when": null, + "workflow_outputs": [] + }, + "57": { + "annotation": "", + "content_id": "wig_to_bigWig", + "errors": null, + "id": 57, + "input_connections": { + "input1": { + "id": 51, + "output_name": "output_treat_pileup" + } + }, + "inputs": [], + "label": "Bigwig from MACS2", + "name": "Wig/BedGraph-to-bigWig", + "outputs": [ + { + "name": "out_file1", + "type": "bigwig" + } + ], + "position": { + "left": 4808.151849816254, + "top": 1251.996347388883 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Peaks per replicate" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "\ud83c\udf1f" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wig_to_bigWig", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "0fe57c5d-00a0-4cb6-9bac-97e6d03c6b76", + "when": null, + "workflow_outputs": [ + { + "label": "peaks_per_replicate", + "output_name": "out_file1", + "uuid": "23ab8786-c4d4-40ed-bef4-acedc42be197" + } + ] + }, + "58": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1", + "errors": null, + "id": 58, + "input_connections": { + "inputs": { + "id": 51, + "output_name": "output_narrowpeaks" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 4790.608440552391, + "top": 1468.3010704169935 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", + "type": "tool", + "uuid": "d2f57b39-897d-4cf3-87f4-fdef2bba9a34", + "when": null, + "workflow_outputs": [] + }, + "59": { + "annotation": "", + "content_id": "__APPLY_RULES__", + "errors": null, + "id": 59, + "input_connections": { + "input": { + "id": 52, + "output_name": "outFileName" + } + }, + "inputs": [], + "label": null, + "name": "Apply rules", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 4993.266797305287, + "top": 2216.028845870027 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__APPLY_RULES__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"rules\": {\"mapping\": [{\"columns\": [1], \"editing\": false, \"type\": \"list_identifiers\"}], \"rules\": [{\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier0\", \"warn\": null}, {\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier1\", \"warn\": null}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0", + "type": "tool", + "uuid": "d2cc1859-dd0f-47dd-a491-507202d83bd1", + "when": null, + "workflow_outputs": [] + }, + "60": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/calculate_numeric_param/calculate_numeric_param/0.1.0", + "errors": null, + "id": 60, + "input_connections": { + "components_0|param_type|component_value": { + "id": 53, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Calculate numeric parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 5414.434887704011, + "top": 674.0866656183726 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/calculate_numeric_param/calculate_numeric_param/0.1.0", + "tool_shed_repository": { + "changeset_revision": "0e586762f97b", + "name": "calculate_numeric_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}, \"arith\": \"+\"}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 0, \"component_value\": \"1\"}, \"arith\": \"\"}], \"output_type\": \"integer\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "70ecbc61-0e0f-4b36-976d-c275b0367af4", + "when": null, + "workflow_outputs": [] + }, + "61": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", + "errors": null, + "id": 61, + "input_connections": { + "results_0|software_cond|input": { + "id": 23, + "output_name": "report_json" + }, + "results_1|software_cond|input": { + "id": 29, + "output_name": "mapping_stats" + }, + "results_2|software_cond|input": { + "id": 54, + "output_name": "output" + } + }, + "inputs": [], + "label": "MultiQC", + "name": "MultiQC", + "outputs": [ + { + "name": "plots", + "type": "input" + }, + { + "name": "html_report", + "type": "html" + }, + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 5055.562870683207, + "top": 831.7856227940173 + }, + "post_job_actions": { + "HideDatasetActionplots": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "plots" + }, + "RenameDatasetActionhtml_report": { + "action_arguments": { + "newname": "MultiQC analysis reports" + }, + "action_type": "RenameDatasetAction", + "output_name": "html_report" + }, + "TagDatasetActionhtml_report": { + "action_arguments": { + "tags": "\ud83d\udd0d" + }, + "action_type": "TagDatasetAction", + "output_name": "html_report" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "f7e2f1eb3a16", + "name": "multiqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastp\", \"__current_case__\": 7, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.24.1+galaxy0", + "type": "tool", + "uuid": "fb066848-43df-412a-9767-9613bac7d961", + "when": null, + "workflow_outputs": [ + { + "label": "multiqc_stats", + "output_name": "stats", + "uuid": "2b8cbf83-886d-438e-887e-82e2deba114e" + }, + { + "label": "multiqc_html", + "output_name": "html_report", + "uuid": "d1b408d8-842b-45da-85d5-7e67d2c17a87" + } + ] + }, + "62": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1", + "errors": null, + "id": 62, + "input_connections": { + "inputs": { + "id": 56, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 4921.295213664614, + "top": 1708.9590342670465 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "86755160afbf", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "9.3+galaxy1", + "type": "tool", + "uuid": "85dd9ee4-d2a0-4c9c-b280-913a751d20ac", + "when": null, + "workflow_outputs": [] + }, + "63": { + "annotation": "", + "content_id": "__APPLY_RULES__", + "errors": null, + "id": 63, + "input_connections": { + "input": { + "id": 57, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Apply rules", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 5025.234311821274, + "top": 1383.635801779973 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__APPLY_RULES__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"rules\": {\"mapping\": [{\"columns\": [1], \"editing\": false, \"type\": \"list_identifiers\"}], \"rules\": [{\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier0\", \"warn\": null}, {\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier1\", \"warn\": null}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0", + "type": "tool", + "uuid": "5a756cf1-34d2-423d-b570-d90a75d3455f", + "when": null, + "workflow_outputs": [] + }, + "64": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_sortbed/2.31.1+galaxy0", + "errors": null, + "id": 64, + "input_connections": { + "input": { + "id": 58, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "bedtools SortBED", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 5010.262154627027, + "top": 1522.1090700056002 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_sortbed/2.31.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "64e2edfe7a2c", + "name": "bedtools", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"genome_file_opts\": {\"genome_file_opts_selector\": \"loc\", \"__current_case__\": 0, \"genome\": null}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.31.1+galaxy0", + "type": "tool", + "uuid": "a2cf62b4-95d9-49af-9c4e-9fbc934b5956", + "when": null, + "workflow_outputs": [] + }, + "65": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 65, + "input_connections": { + "input_collection": { + "id": 59, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 5334.367004120032, + "top": 2262.7786204080885 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.0.2", + "type": "tool", + "uuid": "4bc92cf8-76d0-478c-929a-893a92625df3", + "when": null, + "workflow_outputs": [] + }, + "66": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_sortbed/2.31.1+galaxy0", + "errors": null, + "id": 66, + "input_connections": { + "input": { + "id": 62, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "bedtools SortBED", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 5146.236117612409, + "top": 1757.9605896160601 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_sortbed/2.31.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "64e2edfe7a2c", + "name": "bedtools", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"genome_file_opts\": {\"genome_file_opts_selector\": \"loc\", \"__current_case__\": 0, \"genome\": null}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.31.1+galaxy0", + "type": "tool", + "uuid": "ba5f7bfb-c3bc-4e45-b493-297b4501d514", + "when": null, + "workflow_outputs": [] + }, + "67": { + "annotation": "", + "content_id": "__RELABEL_FROM_FILE__", + "errors": null, + "id": 67, + "input_connections": { + "how|labels": { + "id": 31, + "output_name": "outfile" + }, + "input": { + "id": 63, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Relabel identifiers", + "name": "how" + } + ], + "label": null, + "name": "Relabel identifiers", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 5092.64448656204, + "top": 1185.0581963017723 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__RELABEL_FROM_FILE__", + "tool_state": "{\"how\": {\"how_select\": \"tabular\", \"__current_case__\": 1, \"labels\": {\"__class__\": \"ConnectedValue\"}, \"strict\": false}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "f35e5d52-4d41-4aa4-b8c8-b33a6be98afb", + "when": null, + "workflow_outputs": [] + }, + "68": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1", + "errors": null, + "id": 68, + "input_connections": { + "input": { + "id": 64, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "bedtools MergeBED", + "outputs": [ + { + "name": "output", + "type": "bed" + } + ], + "position": { + "left": 5250.271320891606, + "top": 1579.3295935194308 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1", + "tool_shed_repository": { + "changeset_revision": "64e2edfe7a2c", + "name": "bedtools", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"c_and_o_argument_repeat\": [], \"distance\": \"0\", \"header\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"strand\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.31.1", + "type": "tool", + "uuid": "fae4cb88-ee87-4423-b0b9-079965cb6c0a", + "when": null, + "workflow_outputs": [] + }, + "69": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 69, + "input_connections": { + "input1": { + "id": 65, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 5568.11587681034, + "top": 2253.0534566256933 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": false, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "5d5d6821-2eea-4b54-9490-7ef22ead73e4", + "when": null, + "workflow_outputs": [] + }, + "70": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1", + "errors": null, + "id": 70, + "input_connections": { + "input": { + "id": 66, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "bedtools MergeBED", + "outputs": [ + { + "name": "output", + "type": "bed" + } + ], + "position": { + "left": 5368.293163817283, + "top": 1915.8758273215888 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1", + "tool_shed_repository": { + "changeset_revision": "64e2edfe7a2c", + "name": "bedtools", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"c_and_o_argument_repeat\": [], \"distance\": \"0\", \"header\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"strand\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.31.1", + "type": "tool", + "uuid": "355fca3e-6cc0-454a-aab9-3fe381075940", + "when": null, + "workflow_outputs": [] + }, + "71": { + "annotation": "", + "content_id": "__APPLY_RULES__", + "errors": null, + "id": 71, + "input_connections": { + "input": { + "id": 67, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Apply rules", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 5321.767019440411, + "top": 1425.4757653329539 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__APPLY_RULES__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"rules\": {\"mapping\": [{\"columns\": [1, 2], \"editing\": false, \"type\": \"list_identifiers\"}], \"rules\": [{\"error\": null, \"type\": \"add_column_metadata\", \"value\": \"identifier0\", \"warn\": null}, {\"error\": null, \"expression\": \"(.+)_(\\\\d+)\", \"group_count\": 2, \"replacement\": null, \"target_column\": 0, \"type\": \"add_column_regex\", \"warn\": null}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0", + "type": "tool", + "uuid": "ae68e55b-1f4f-40d5-bc92-0ece04a8963e", + "when": null, + "workflow_outputs": [] + }, + "72": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_compute_matrix/deeptools_compute_matrix/3.5.4+galaxy0", + "errors": null, + "id": 72, + "input_connections": { + "multibigwig_conditional|bigwigfiles": { + "id": 52, + "output_name": "outFileName" + }, + "regionsFiles_0|regionsFile": { + "id": 68, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool computeMatrix", + "name": "advancedOpt" + }, + { + "description": "runtime parameter for tool computeMatrix", + "name": "multibigwig_conditional" + } + ], + "label": null, + "name": "computeMatrix", + "outputs": [ + { + "name": "outFileName", + "type": "deeptools_compute_matrix_archive" + } + ], + "position": { + "left": 5551.394104212098, + "top": 1633.9066101050357 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_compute_matrix/deeptools_compute_matrix/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "a60c359ec43c", + "name": "deeptools_compute_matrix", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": \"50\", \"sortRegions\": \"keep\", \"sortUsing\": \"mean\", \"averageTypeBins\": \"mean\", \"missingDataAsZero\": true, \"skipZeros\": true, \"minThreshold\": null, \"maxThreshold\": null, \"scale\": null, \"metagene\": false, \"transcriptID\": \"transcript\", \"exonID\": \"exon\", \"transcript_id_designator\": \"transcript_id\", \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"custom_sample_labels_conditional\": {\"custom_labels_select\": \"No\", \"__current_case__\": 0}, \"mode\": {\"mode_select\": \"reference-point\", \"__current_case__\": 1, \"referencePoint\": \"center\", \"nanAfterEnd\": false, \"beforeRegionStartLength\": \"3000\", \"afterRegionStartLength\": \"3000\"}, \"multibigwig_conditional\": {\"orderMatters\": \"No\", \"__current_case__\": 0, \"bigwigfiles\": {\"__class__\": \"ConnectedValue\"}}, \"output\": {\"showOutputSettings\": \"no\", \"__current_case__\": 0}, \"regionsFiles\": [{\"__index__\": 0, \"regionsFile\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "16eeab2c-fdb0-4217-9ef4-d65d4a092b8a", + "when": null, + "workflow_outputs": [] + }, + "73": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 73, + "input_connections": { + "input1": { + "id": 69, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 5796.6703301075295, + "top": 2214.845644382288 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "81751af5-8e85-49ef-8698-7afe580894d0", + "when": null, + "workflow_outputs": [] + }, + "74": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_compute_matrix/deeptools_compute_matrix/3.5.4+galaxy0", + "errors": null, + "id": 74, + "input_connections": { + "multibigwig_conditional|bigwigfiles": { + "id": 59, + "output_name": "output" + }, + "regionsFiles_0|regionsFile": { + "id": 70, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool computeMatrix", + "name": "advancedOpt" + }, + { + "description": "runtime parameter for tool computeMatrix", + "name": "multibigwig_conditional" + } + ], + "label": null, + "name": "computeMatrix", + "outputs": [ + { + "name": "outFileName", + "type": "deeptools_compute_matrix_archive" + } + ], + "position": { + "left": 5641.443721637562, + "top": 1952.614017550237 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_compute_matrix/deeptools_compute_matrix/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "a60c359ec43c", + "name": "deeptools_compute_matrix", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": \"50\", \"sortRegions\": \"keep\", \"sortUsing\": \"mean\", \"averageTypeBins\": \"mean\", \"missingDataAsZero\": true, \"skipZeros\": true, \"minThreshold\": null, \"maxThreshold\": null, \"scale\": null, \"metagene\": false, \"transcriptID\": \"transcript\", \"exonID\": \"exon\", \"transcript_id_designator\": \"transcript_id\", \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"custom_sample_labels_conditional\": {\"custom_labels_select\": \"No\", \"__current_case__\": 0}, \"mode\": {\"mode_select\": \"reference-point\", \"__current_case__\": 1, \"referencePoint\": \"center\", \"nanAfterEnd\": false, \"beforeRegionStartLength\": \"3000\", \"afterRegionStartLength\": \"3000\"}, \"multibigwig_conditional\": {\"orderMatters\": \"No\", \"__current_case__\": 0, \"bigwigfiles\": {\"__class__\": \"ConnectedValue\"}}, \"output\": {\"showOutputSettings\": \"no\", \"__current_case__\": 0}, \"regionsFiles\": [{\"__index__\": 0, \"regionsFile\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "a353aee5-7309-41d2-99a1-2d24a71560c6", + "when": null, + "workflow_outputs": [] + }, + "75": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", + "errors": null, + "id": 75, + "input_connections": { + "bigwigs": { + "id": 71, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "bigwigAverage", + "outputs": [ + { + "name": "outFileName", + "type": "bigwig" + } + ], + "position": { + "left": 5376.223772610315, + "top": 1177.6322714145876 + }, + "post_job_actions": { + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "Peaks averaged across replicates" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + }, + "TagDatasetActionoutFileName": { + "action_arguments": { + "tags": "\ud83c\udf1f" + }, + "action_type": "TagDatasetAction", + "output_name": "outFileName" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "4a53856a5b85", + "name": "deeptools_bigwig_average", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"no\", \"__current_case__\": 0}, \"bigwigs\": {\"__class__\": \"ConnectedValue\"}, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "4d5765f4-a5a5-4aa8-b432-f374261acff7", + "when": null, + "workflow_outputs": [ + { + "label": "peaks_averaged_across_replicates", + "output_name": "outFileName", + "uuid": "42af7412-853b-4b96-8570-790bdb587f81" + } + ] + }, + "76": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_plot_heatmap/deeptools_plot_heatmap/3.5.4+galaxy0", + "errors": null, + "id": 76, + "input_connections": { + "advancedOpt|used_multiple_regions|clustering|k_kmeans": { + "id": 60, + "output_name": "integer_param" + }, + "matrixFile": { + "id": 72, + "output_name": "outFileName" + } + }, + "inputs": [], + "label": null, + "name": "plotHeatmap", + "outputs": [ + { + "name": "outFileName", + "type": "png" + } + ], + "position": { + "left": 5790.249568964471, + "top": 1179.410656223279 + }, + "post_job_actions": { + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "Per-replicate clustered heatmaps of peaks" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + }, + "TagDatasetActionoutFileName": { + "action_arguments": { + "tags": "\ud83d\udd0d" + }, + "action_type": "TagDatasetAction", + "output_name": "outFileName" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_plot_heatmap/deeptools_plot_heatmap/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "e4c7985d4585", + "name": "deeptools_plot_heatmap", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"sortRegions\": \"descend\", \"sortUsing\": \"mean\", \"sortUsingSamples\": null, \"linesAtTickMarks\": false, \"averageTypeSummaryPlot\": \"mean\", \"plotType\": \"lines\", \"missingDataColor\": \"black\", \"colorMapRepeat\": [], \"alpha\": \"1.0\", \"colorList\": \"\", \"zMin\": \"\", \"zMax\": \"\", \"yMin\": null, \"yMax\": null, \"xAxisLabel\": \"distance from region center (bp)\", \"yAxisLabel\": \"peak regions\", \"heatmapWidth\": \"7.5\", \"heatmapHeight\": \"25.0\", \"whatToShow\": \"plot, heatmap and colorbar\", \"startLabel\": \"peak start\", \"endLabel\": \"peak end\", \"referencePointLabel\": \"peak center\", \"samplesLabel\": null, \"regionsLabel\": null, \"plotTitle\": \"\", \"legendLocation\": \"best\", \"labelRotation\": \"0\", \"perGroup\": false, \"used_multiple_regions\": {\"used_multiple_regions_options\": \"no\", \"__current_case__\": 0, \"clustering\": {\"clustering_options\": \"kmeans\", \"__current_case__\": 0, \"k_kmeans\": {\"__class__\": \"ConnectedValue\"}}, \"silhouette\": false}, \"clusterUsingSamples\": null}, \"matrixFile\": {\"__class__\": \"ConnectedValue\"}, \"output\": {\"showOutputSettings\": \"no\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "ff8a6416-3798-4a34-92ab-d4091a240830", + "when": null, + "workflow_outputs": [ + { + "label": "peaks_heatmap_per_replicate", + "output_name": "outFileName", + "uuid": "b956cbd5-d609-4476-99ca-14b79afb2a05" + } + ] + }, + "77": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/calculate_numeric_param/calculate_numeric_param/0.1.0", + "errors": null, + "id": 77, + "input_connections": { + "components_0|param_type|component_value": { + "id": 73, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Calculate numeric parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 6021.761837142641, + "top": 2031.3094924921204 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/calculate_numeric_param/calculate_numeric_param/0.1.0", + "tool_shed_repository": { + "changeset_revision": "0e586762f97b", + "name": "calculate_numeric_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}, \"arith\": \"+\"}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 0, \"component_value\": \"1\"}, \"arith\": \"\"}], \"output_type\": \"integer\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "cdd2f146-6086-4bec-b1c1-9f273ed951ce", + "when": null, + "workflow_outputs": [] + }, + "78": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_plot_heatmap/deeptools_plot_heatmap/3.5.4+galaxy0", + "errors": null, + "id": 78, + "input_connections": { + "advancedOpt|used_multiple_regions|clustering|k_kmeans": { + "id": 77, + "output_name": "integer_param" + }, + "matrixFile": { + "id": 74, + "output_name": "outFileName" + } + }, + "inputs": [], + "label": null, + "name": "plotHeatmap", + "outputs": [ + { + "name": "outFileName", + "type": "png" + } + ], + "position": { + "left": 6062.768920644284, + "top": 1445.8118637992488 + }, + "post_job_actions": { + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "Clustered heatmap of peaks across all samples" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + }, + "TagDatasetActionoutFileName": { + "action_arguments": { + "tags": "\ud83d\udd0d" + }, + "action_type": "TagDatasetAction", + "output_name": "outFileName" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_plot_heatmap/deeptools_plot_heatmap/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "e4c7985d4585", + "name": "deeptools_plot_heatmap", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"sortRegions\": \"descend\", \"sortUsing\": \"mean\", \"sortUsingSamples\": null, \"linesAtTickMarks\": false, \"averageTypeSummaryPlot\": \"mean\", \"plotType\": \"lines\", \"missingDataColor\": \"black\", \"colorMapRepeat\": [], \"alpha\": \"1.0\", \"colorList\": \"\", \"zMin\": \"\", \"zMax\": \"\", \"yMin\": null, \"yMax\": null, \"xAxisLabel\": \"distance from region center (bp)\", \"yAxisLabel\": \"peak regions\", \"heatmapWidth\": \"7.5\", \"heatmapHeight\": \"25.0\", \"whatToShow\": \"plot, heatmap and colorbar\", \"startLabel\": \"peak start\", \"endLabel\": \"peak end\", \"referencePointLabel\": \"peak center\", \"samplesLabel\": null, \"regionsLabel\": null, \"plotTitle\": \"\", \"legendLocation\": \"best\", \"labelRotation\": \"0\", \"perGroup\": false, \"used_multiple_regions\": {\"used_multiple_regions_options\": \"no\", \"__current_case__\": 0, \"clustering\": {\"clustering_options\": \"kmeans\", \"__current_case__\": 0, \"k_kmeans\": {\"__class__\": \"ConnectedValue\"}}, \"silhouette\": false}, \"clusterUsingSamples\": null}, \"matrixFile\": {\"__class__\": \"ConnectedValue\"}, \"output\": {\"showOutputSettings\": \"no\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "43e6e642-909f-411a-8a8d-b4d1dd1edf82", + "when": null, + "workflow_outputs": [ + { + "label": "peaks_heatmap", + "output_name": "outFileName", + "uuid": "121c315b-a034-45c3-b625-5be54466b680" + } + ] + } + }, + "tags": [ + "ChIP-Seq" + ] +} diff --git a/workflows/epigenetics/chipseq-pe-with-replicates-controls/test-data/test_sample_sheet.tsv b/workflows/epigenetics/chipseq-pe-with-replicates-controls/test-data/test_sample_sheet.tsv new file mode 100644 index 000000000..096b58c0a --- /dev/null +++ b/workflows/epigenetics/chipseq-pe-with-replicates-controls/test-data/test_sample_sheet.tsv @@ -0,0 +1,4 @@ +SRR5204807 Spt5 rep1 SRR5204809 +SRR5204808 Spt5 rep2 SRR5204810 +SRR5204809 input rep1 . +SRR5204810 input rep2 .