diff --git a/README.md b/README.md
index aadebe3..40d5956 100644
--- a/README.md
+++ b/README.md
@@ -16,3 +16,16 @@ These catalogs were used to call tandem repeat genotypes using TRGT by the [Plat
 The command `trf-mod -s 20 -l 160 {reference.fasta}` was used, resulting in a minimum reference locus size of 10 bp and motif sizes of 1 to 2000 bp, see [TRF-mod](https://github.com/lh3/TRF-mod). Loci within 50 bp were merged, and then any loci >10,000 bp were discarded. The remaining loci were annotated with [tr-solve](https://github.com/trgt-paper/tr-solve) to resolve locus structure in compound loci. Only TRs annotated on chromosomes 1-22, X, and Y were considered.
 
 The catalogs are available on Zenodo [DOI 10.5281/zenodo.13178745](https://zenodo.org/doi/10.5281/zenodo.13178745)
+
+### Example usage:
+
+```
+conda activate trgtdist
+
+# VCF
+./tr-solve2TRGT.py --trtools tr-solve-v0.2.0-linux_x86_64 example.vcf
+
+# BED + FASTA
+./tr-solve2TRGT.py --trtools tr-solve-v0.2.0-linux_x86_64 --fasta human_g1k_v38_decoy_phix.fasta GRCh38.UCSC.SimpleRepeats.sample.bed
+
+```
diff --git a/TRlib.py b/TRlib.py
new file mode 100644
index 0000000..d45079e
--- /dev/null
+++ b/TRlib.py
@@ -0,0 +1,93 @@
+import pysam
+import pathlib
+import sys
+import re
+
+def extractfasta(bed: pathlib.Path, fasta: pathlib.Path, maxout: int = 10000, returninfo: bool = False):
+    """
+    Extract sequences from a FASTA file using a BED file.
+    :param bed: Path to the BED file.
+    :param fasta: Path to the FASTA file.
+    :param maxout: Maximum region size to output (smaller ones skipped).
+    :param returninfo: Return the locus information as well as the sequence.
+    :return: DNA sequence as a string.
+    """
+    # read fasta file
+    ref = pysam.FastaFile(fasta)
+
+    with open(bed) as f:
+        for line in f:
+            locus = line.strip().split()
+            if maxout is not None and int(locus[2]) - int(locus[1]) > maxout:
+                continue
+            try:
+                sequence = ref.fetch(locus[0], int(locus[1]), int(locus[2]))
+            except KeyError as e:
+                sys.stderr.write(f'Error: {e}\n')
+                continue
+            if returninfo:
+                yield (locus[0], locus[1], locus[2], locus[3]), sequence
+            else:
+                yield (locus[0], locus[1], locus[2]), [sequence]
+
+def longesthomopolymer(sequence):
+    """
+    Find the longest homopolymer in a sequence. 
+    If there are multiple longest homopolymers, the last one is returned.
+    Split on Ns
+    :param sequence: DNA sequence as a string.
+    :return: length of the longest homopolymer.
+
+    >>> longesthomopolymer('ATTTTGGGGGCCCCC')
+    5
+    >>> longesthomopolymer('ATTTTGGGGGNNNNNNNCCCCC')
+    5
+    >>> longesthomopolymer('ATTNTTGGGNGGNNNNNNNCCCNCC')
+    3
+    >>> longesthomopolymer('') is None
+    True
+    >>> longesthomopolymer('NNNNNNNNNNNNNN') is None
+    True
+    """
+    # if sequence is all Ns, return None
+    if len(sequence) == sequence.count('N'):
+        return None
+    maximum = count = 0
+    for s in filter(None, re.split('N', sequence, flags=re.IGNORECASE)):
+        current = ''
+        for c in s:
+            if c == current:
+                count += 1
+            else:
+                count = 1
+                current = c
+            maximum = max(count,maximum)
+    return maximum
+
+def GCcontent(sequence):
+    """
+    Calculate the GC content of a sequence.
+    :param sequence: DNA sequence as a string.
+    :return: GC content as a float.
+
+    >>> GCcontent('ATTTTGGGGGCCCCCATTTT')
+    0.5
+    >>> GCcontent('ATTT')
+    0.0
+    >>> GCcontent('ATTTTGGGGGNNNNNNNNNNNCCCCCATTTT')
+    0.5
+    >>> GCcontent('GGGGCCC')
+    1.0
+    >>> GCcontent('') is None
+    True
+    >>> GCcontent('NNNNNNNNNNN') is None
+    True
+    """
+    if len(sequence) == sequence.count('N'):
+        return None
+    sequence = sequence.upper()
+    return (sequence.count('G') + sequence.count('C')) / (len(sequence) - sequence.count('N'))
+
+if __name__ == "__main__":
+    import doctest
+    doctest.testmod()
\ No newline at end of file
diff --git a/annotateTRGTdefinitions.py b/annotateTRGTdefinitions.py
new file mode 100644
index 0000000..a7f66f9
--- /dev/null
+++ b/annotateTRGTdefinitions.py
@@ -0,0 +1,89 @@
+import pandas as pd
+import bioframe as bf
+import os
+import sys
+import TRlib
+
+def annotateFasta(trgt_definitions: str, fasta: str):
+        """Extract the sequence from the FASTA file using the locus coordinates
+        and annotate the TRGT definitions with the sequence and other information."""
+        for (chrom, start, end, info), sequence in TRlib.extractfasta(trgt_definitions, fasta, maxout=None, returninfo=True):
+
+            TRid = info.split(';')[0].split('=')[1]
+            motifs = info.split(';')[1].split('=')[1]
+            motifslist = motifs.split(',')
+            struc = info.split(';')[2].split('=')[1]
+            longest_homopolymer = TRlib.longesthomopolymer(sequence)
+            if longest_homopolymer is None:
+                longest_homopolymer = 'NA'
+            gc_content = TRlib.GCcontent(sequence)
+            if gc_content is None:
+                gc_content = 'NA'
+            n_motifs = len(motifslist)
+            min_motiflen = len(min(motifslist, key=len))
+            max_motiflen = len(max(motifslist, key=len))
+
+            result = [chrom, int(start), int(end), TRid,
+                        longest_homopolymer, gc_content, 
+                        n_motifs, min_motiflen, max_motiflen,
+                        motifs, struc,
+                    ]
+            yield result
+
+def main(trgt_definitions: str, fasta: str, *, output: str = 'stdout', bed_files: list[str] = None, bed_names: list[str] = None):
+        """
+        Outputs a bed file with annotated TRGT definitions including length of longest homopolymer, 
+        GC content, number of motifs, min and max motif length, and motifs.
+        If annotation bed files are provided, number of bp overlap is reported.
+
+        :param trgt_definitions: Path to the TRGT definitions bed file
+        :param fasta: Path to the reference FASTA file
+        :param bed_files: Paths to one or more bed files
+        :param bed_names: Column names for the bed files (must be the same length as bed_files)
+        :output: bed files with annotated TRGT definitions
+        """
+        if output != 'stdout':
+            outstream = open(output, 'w')
+            sys.stdout = outstream
+        else:
+            outstream = sys.stdout
+
+        header = ['chrom', 'start', 'end', 'TRid',
+                    'longest_homopolymer', 'gc_content', 
+                    'n_motifs', 'min_motiflen', 'max_motiflen',
+                    'motifs', 'struc',
+                ]
+
+        if bed_files:
+            if bed_names:
+                if len(bed_names) != len(bed_files):
+                    raise ValueError('bed_names must be the same length as bed_files')
+            else:
+                bed_names = [os.path.splitext(os.path.basename(bed_file))[0] for bed_file in bed_files]
+
+        trgt_df = pd.DataFrame(columns=header, data=annotateFasta(trgt_definitions, fasta))
+
+        # Read the bed files into a dictionary of pandas DataFrames
+        bed_dfs = {}
+        if bed_files:
+            for bed_name, bed_file in zip(bed_names,bed_files):
+                bed_dfs[bed_name] = pd.read_csv(bed_file, sep='\t', header=None)
+                colnames = [str(x) for x in bed_dfs[bed_name].columns]
+                colnames[:3] = ['chrom', 'start', 'end']
+                bed_dfs[bed_name].columns = colnames
+
+        # Overlap the bed files with the TRGT DataFrame
+        for bed_name, bed_df in bed_dfs.items():
+            trgt_df = bf.coverage(trgt_df, bed_df)
+            trgt_df = trgt_df.rename(columns={'coverage':bed_name})
+
+        # Write the TRGT definitions with annotations to the output file
+        trgt_df = trgt_df.rename(columns={'chrom':'#chrom'})
+        trgt_df.to_csv(outstream, sep='\t', header=True, index=False)
+
+
+if __name__ == "__main__":
+    import doctest
+    doctest.testmod()
+    import defopt
+    defopt.run(main)
\ No newline at end of file
diff --git a/tr-solve2TRGT.py b/tr-solve2TRGT.py
new file mode 100755
index 0000000..941ea99
--- /dev/null
+++ b/tr-solve2TRGT.py
@@ -0,0 +1,180 @@
+#!/usr/bin/env python
+
+import sys
+import cyvcf2
+import pathlib
+import subprocess
+import re
+import pysam
+from itertools import groupby
+from TRlib import extractfasta
+
+def extractvcf(infile: pathlib.Path, minins: int = 8):
+    cyvcf2_vcf = cyvcf2.VCF(infile)
+    for locus in cyvcf2_vcf:
+        if locus.INFO['SVTYPE'] == 'INS' and locus.INFO['SVLEN'] >= minins:
+            yield (locus.CHROM, locus.POS, locus.POS), locus.ALT
+
+def parsetrsolve(motif_string: str):
+    """
+    Parse the output of tr-solve version 0.2.1+
+    Parse the motifs and their start/end positions
+    e.g. 'CAG_0_18,A_18_38' -> ['CAG', 'A'], [0, 38]
+    
+    >>> parsetrsolve('AGAGGCGCGGCGCGCCGGCGCAGGCGCAG_0_597')
+    ('AGAGGCGCGGCGCGCCGGCGCAGGCGCAG', 0, 597)
+    >>> parsetrsolve('CAG_0_18')
+    ('CAG', 0, 18)
+    >>> parsetrsolve('A_18_38')
+    ('A', 18, 38)
+    """
+
+    motif, start, end = motif_string.split('_')
+        # except ValueError as e:
+        #     sys.stderr.write(f'Error: Cannot parse {motif_list} - {e}\n')
+        #     raise
+    assert 'N' not in motif, f'N found in motif: {motif}'
+    start = int(start)
+    end = int(end)
+
+    return motif, start, end
+
+def runtrsolve(sequence: str, trsolve: pathlib.Path):
+    """
+    Run tr-solve on a sequence by calling the binary.
+    Example command:
+    echo input | tr-solve > output
+    Report the bases of the TRGT motifs.
+
+    DNA sequence as a string.
+    Return a list of TRGT motifs and the start/end of the left and rightmost motifs.
+
+
+    >>> runtrsolve('ATATATATATATATATATATATAT', trsolve='~/tools/tr-solve-v0.2.1-linux_x86_64')
+    (['AT'], [0, 24])
+    >>> runtrsolve('CAGCAGCAGCAGCAGCAGAAAAAAAAAAAAAAAAAAAA', trsolve='~/tools/tr-solve-v0.2.1-linux_x86_64')
+    (['CAG', 'A'], [0, 38])
+    >>> runtrsolve('GGCACGGCATATATATATATATATATATATAT', trsolve='~/tools/tr-solve-v0.2.1-linux_x86_64')
+    (['AT'], [8, 32])
+    """
+    sequence = sequence.upper()
+    if 'N' in sequence:
+        sys.stderr.write(f'N found in sequence: {sequence}\n')
+        # Remove Ns from the sequence
+        sequence = re.sub('N', '', sequence)
+        sys.stderr.write(f'Removed Ns from sequence to produce: {sequence}\n')
+    command = f'echo {sequence} | {trsolve}'
+    #sys.stderr.write(f'Running: {command}\n')
+    try:
+        result = subprocess.run(command, shell=True, check=True,
+                            stdout=subprocess.PIPE, stderr=subprocess.PIPE)
+    except subprocess.CalledProcessError as e:
+        sys.stderr.write(f'Error: {command}\n')
+        sys.stderr.write(f'{e.stderr.decode("utf-8")}\n')
+        return [], [None, None] #XXX: Should this be an error?
+    
+    motif_string_list = result.stdout.decode('utf-8').strip().split('\t')
+    if len(motif_string_list) < 3: # No motif structure reported
+        return [], [None, None]
+    
+    # Trim the positions to the bases covered by the motifs
+    minpos = None
+    maxpos = None
+    motifs = []
+
+    for motif_string in motif_string_list[2].split(','):
+        motif, start, end = parsetrsolve(motif_string)
+
+        motifs.append(motif)
+        if minpos is None:
+            minpos = int(start)
+        if maxpos is None:
+            maxpos = int(end)
+        if int(start) < minpos:
+            minpos = int(start)
+        if int(end) > maxpos:
+            maxpos = int(end)
+
+    return motifs, [minpos, maxpos]
+
+def rmdup(seq):
+    """remove adjacent duplicates from a list
+
+    >>> rmdup([1, 1, 2, 3, 3, 3, 4, 5, 5])
+    [1, 2, 3, 4, 5]
+    >>> rmdup(['a', 'a', 'b', 'c', 'c', 'c', 'a', 'd', 'e', 'e'])
+    ['a', 'b', 'c', 'a', 'd', 'e']
+    """
+    return [x[0] for x in groupby(seq)]
+
+def main(infile: pathlib.Path, outfile: str = 'stdout', *, 
+         fasta: pathlib.Path = None, minins: int = 8, maxout: int = 10000,
+         trtools: pathlib.Path = pathlib.Path('tr-solve'),
+         seqout: bool = False, trim: bool = False):
+    """
+    Convert a VCF or BED file to TRGT repeat definitions.
+    :param infile: Path to the input VCF or BED file.
+    :param outfile: Path to the output TRGT repeat definitions file.
+    :param fasta: Path to the reference FASTA file (required for BED inputs).
+    :param minins: Minimum insertion size to use from VCF.
+    :param maxout: Maximum region size to output (smaller ones skipped).
+    :param trtools: Path to the tr-solve binary.
+    :param seqout: Output all input sequences. When false, sequences with no motif found are skipped.
+    :param trim: Trim the output coordinates to the bases covered by the motifs.
+    """
+    if infile.suffix == '.vcf' or infile.suffixes[-2:] == ['.vcf', '.gz']:
+        sequences = extractvcf(infile, minins=minins)
+    elif infile.suffix == '.bed':
+        if fasta is None:
+            raise ValueError('BED input requires FASTA file')
+        sequences = extractfasta(infile, fasta, maxout=maxout)
+    else:
+        raise ValueError(f'Unknown input file type: {infile.suffix}')
+    
+    if outfile == 'stdout':
+        f = sys.stdout
+    else:
+        f = open(outfile, 'w')
+
+    for (chrom, start_orig, end_orig), alts in sequences:
+        for alt in alts:
+            motifs, bounds = runtrsolve(alt, trsolve=trtools)
+            #sys.stderr.write(f'{motifs}\t{bounds}\n')
+            
+            if len(motifs) == 0:
+                if seqout:
+                    f.write(f'{alt}\tNone\n')
+                continue
+            start = int(start_orig)
+            end = int(end_orig)
+
+            if trim:
+
+                # Trim the bounds to the bases covered by the motifs
+                if bounds[0] is not None:
+                    start += bounds[0]
+                if bounds[1] is not None:
+                    end = start + bounds[1] - bounds[0]
+
+                if start > int(end_orig):
+                    start = int(end_orig)
+                if end < int(start_orig):
+                    end = int(start_orig)
+
+            unique_motifs = dict.fromkeys(motifs) # can use set(motifs) if order doesn't matter. Assume it does for now
+            motifs_str = ','.join(unique_motifs)
+            struc = ''.join([f'({motif})n' for motif in rmdup(motifs)])
+            if seqout:
+                outstring = f'{alt}\t'
+            else:
+                outstring = ''
+            outstring += f'{chrom}\t{start}\t{end}\tID={chrom}_{start}_{end};MOTIFS={motifs_str};STRUC={struc}\n'
+            f.write(outstring)
+
+    f.flush()
+
+if __name__ == "__main__":
+    import doctest
+    doctest.testmod()
+    import defopt
+    defopt.run(main)
\ No newline at end of file