diff --git a/examples/24_helix_rectangle.dna b/examples/24_helix_rectangle.dna index b430b07a..7eb88a55 100644 --- a/examples/24_helix_rectangle.dna +++ b/examples/24_helix_rectangle.dna @@ -27,83 +27,6 @@ {"grid_position": [0, 20], "max_offset": 304} ], "strands": [ - { - "color": "#0066cc", - "is_scaffold": true, - "substrands": [ - {"helix": 16, "forward": true, "start": 8, "end": 152}, - {"helix": 15, "forward": false, "start": 8, "end": 152}, - {"helix": 14, "forward": true, "start": 8, "end": 152}, - {"helix": 13, "forward": false, "start": 8, "end": 152}, - {"helix": 12, "forward": true, "start": 8, "end": 152}, - {"helix": 11, "forward": false, "start": 8, "end": 152}, - {"helix": 10, "forward": true, "start": 8, "end": 152}, - {"helix": 9, "forward": false, "start": 8, "end": 152}, - {"helix": 8, "forward": true, "start": 8, "end": 152} - ] - }, - { - "color": "#0066cc", - "is_scaffold": true, - "substrands": [ - {"helix": 8, "forward": true, "start": 152, "end": 296}, - {"helix": 9, "forward": false, "start": 152, "end": 296}, - {"helix": 10, "forward": true, "start": 152, "end": 296}, - {"helix": 11, "forward": false, "start": 152, "end": 296}, - {"helix": 12, "forward": true, "start": 152, "end": 296}, - {"helix": 13, "forward": false, "start": 152, "end": 296}, - {"helix": 14, "forward": true, "start": 152, "end": 296}, - {"helix": 15, "forward": false, "start": 152, "end": 296}, - {"helix": 16, "forward": true, "start": 152, "end": 296} - ] - }, - { - "color": "#0066cc", - "is_scaffold": true, - "substrands": [ - {"helix": 23, "forward": false, "start": 8, "end": 152}, - {"helix": 22, "forward": true, "start": 8, "end": 152}, - {"helix": 21, "forward": false, "start": 8, "end": 152}, - {"helix": 20, "forward": true, "start": 8, "end": 152}, - {"helix": 19, "forward": false, "start": 8, "end": 152}, - {"helix": 18, "forward": true, "start": 8, "end": 152}, - {"helix": 17, "forward": false, "start": 8, "end": 152} - ] - }, - { - "color": "#0066cc", - "is_scaffold": true, - "substrands": [ - {"helix": 17, "forward": false, "start": 152, "end": 296}, - {"helix": 18, "forward": true, "start": 152, "end": 296}, - {"helix": 19, "forward": false, "start": 152, "end": 296}, - {"helix": 20, "forward": true, "start": 152, "end": 296}, - {"helix": 21, "forward": false, "start": 152, "end": 296}, - {"helix": 22, "forward": true, "start": 152, "end": 296}, - {"helix": 23, "forward": false, "start": 152, "end": 296} - ] - }, - { - "color": "#0066cc", - "is_scaffold": true, - "substrands": [ - {"helix": 7, "forward": false, "start": 8, "end": 152}, - {"helix": 6, "forward": true, "start": 8, "end": 152}, - {"helix": 5, "forward": false, "start": 8, "end": 152}, - {"helix": 4, "forward": true, "start": 8, "end": 152}, - {"helix": 3, "forward": false, "start": 8, "end": 152}, - {"helix": 2, "forward": true, "start": 8, "end": 152}, - {"helix": 1, "forward": false, "start": 8, "end": 152}, - {"helix": 0, "forward": true, "start": 8, "end": 296}, - {"helix": 1, "forward": false, "start": 152, "end": 296}, - {"helix": 2, "forward": true, "start": 152, "end": 296}, - {"helix": 3, "forward": false, "start": 152, "end": 296}, - {"helix": 4, "forward": true, "start": 152, "end": 296}, - {"helix": 5, "forward": false, "start": 152, "end": 296}, - {"helix": 6, "forward": true, "start": 152, "end": 296}, - {"helix": 7, "forward": false, "start": 152, "end": 296} - ] - }, { "color": "#cc0000", "substrands": [ @@ -1767,6 +1690,59 @@ {"helix": 1, "forward": true, "start": 176, "end": 184}, {"helix": 0, "forward": false, "start": 160, "end": 184} ] + }, + { + "color": "#0066cc", + "is_scaffold": true, + "substrands": [ + {"helix": 23, "forward": false, "start": 8, "end": 152}, + {"helix": 22, "forward": true, "start": 8, "end": 152}, + {"helix": 21, "forward": false, "start": 8, "end": 152}, + {"helix": 20, "forward": true, "start": 8, "end": 152}, + {"helix": 19, "forward": false, "start": 8, "end": 152}, + {"helix": 18, "forward": true, "start": 8, "end": 152}, + {"helix": 17, "forward": false, "start": 8, "end": 152}, + {"helix": 16, "forward": true, "start": 8, "end": 152}, + {"helix": 15, "forward": false, "start": 8, "end": 152}, + {"helix": 14, "forward": true, "start": 8, "end": 152}, + {"helix": 13, "forward": false, "start": 8, "end": 152}, + {"helix": 12, "forward": true, "start": 8, "end": 152}, + {"helix": 11, "forward": false, "start": 8, "end": 152}, + {"helix": 10, "forward": true, "start": 8, "end": 152}, + {"helix": 9, "forward": false, "start": 8, "end": 152}, + {"helix": 8, "forward": true, "start": 8, "end": 152}, + {"helix": 7, "forward": false, "start": 8, "end": 152}, + {"helix": 6, "forward": true, "start": 8, "end": 152}, + {"helix": 5, "forward": false, "start": 8, "end": 152}, + {"helix": 4, "forward": true, "start": 8, "end": 152}, + {"helix": 3, "forward": false, "start": 8, "end": 152}, + {"helix": 2, "forward": true, "start": 8, "end": 152}, + {"helix": 1, "forward": false, "start": 8, "end": 152}, + {"helix": 0, "forward": true, "start": 8, "end": 296}, + {"helix": 1, "forward": false, "start": 152, "end": 296}, + {"helix": 2, "forward": true, "start": 152, "end": 296}, + {"helix": 3, "forward": false, "start": 152, "end": 296}, + {"helix": 4, "forward": true, "start": 152, "end": 296}, + {"helix": 5, "forward": false, "start": 152, "end": 296}, + {"helix": 6, "forward": true, "start": 152, "end": 296}, + {"helix": 7, "forward": false, "start": 152, "end": 296}, + {"helix": 8, "forward": true, "start": 152, "end": 296}, + {"helix": 9, "forward": false, "start": 152, "end": 296}, + {"helix": 10, "forward": true, "start": 152, "end": 296}, + {"helix": 11, "forward": false, "start": 152, "end": 296}, + {"helix": 12, "forward": true, "start": 152, "end": 296}, + {"helix": 13, "forward": false, "start": 152, "end": 296}, + {"helix": 14, "forward": true, "start": 152, "end": 296}, + {"helix": 15, "forward": false, "start": 152, "end": 296}, + {"helix": 16, "forward": true, "start": 152, "end": 296}, + {"helix": 17, "forward": false, "start": 152, "end": 296}, + {"helix": 18, "forward": true, "start": 152, "end": 296}, + {"helix": 19, "forward": false, "start": 152, "end": 296}, + {"helix": 20, "forward": true, "start": 152, "end": 296}, + {"helix": 21, "forward": false, "start": 152, "end": 296}, + {"helix": 22, "forward": true, "start": 152, "end": 296}, + {"helix": 23, "forward": false, "start": 152, "end": 296} + ] } ] } \ No newline at end of file diff --git a/examples/24_helix_rectangle_twist_corrected.dna b/examples/24_helix_rectangle_twist_corrected.dna index 55fd4394..422cc1bc 100644 --- a/examples/24_helix_rectangle_twist_corrected.dna +++ b/examples/24_helix_rectangle_twist_corrected.dna @@ -1,1767 +1,1964 @@ -{ - "version": "0.1.0", - "helices": [ - {"max_offset": 304, "grid_position": [0, -3], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, -2], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, -1], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 0], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 1], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 2], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 3], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 4], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 5], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 6], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 7], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 8], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 9], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 10], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 11], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 12], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 13], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 14], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 15], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 16], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 17], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 18], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 19], "rotation": -90.0}, - {"max_offset": 304, "grid_position": [0, 20], "rotation": -90.0} - ], - "strands": [ - { - "color": "#0066cc", - "substrands": [ - {"helix": 16, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 15, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 14, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 13, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 12, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 11, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 10, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 9, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 8, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]} - ] - }, - { - "color": "#0066cc", - "substrands": [ - {"helix": 8, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 9, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 10, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 11, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 12, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 13, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 14, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 15, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 16, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]} - ] - }, - { - "color": "#0066cc", - "substrands": [ - {"helix": 23, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 22, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 21, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 20, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 19, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 18, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 17, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]} - ] - }, - { - "color": "#0066cc", - "substrands": [ - {"helix": 17, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 18, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 19, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 20, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 21, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 22, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 23, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]} - ] - }, - { - "color": "#0066cc", - "substrands": [ - {"helix": 7, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 6, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 5, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 4, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 3, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 2, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 1, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, - {"helix": 0, "forward": true, "start": 8, "end": 296, "deletions": [27, 75, 123, 171, 219, 267]}, - {"helix": 1, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 2, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 3, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 4, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 5, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 6, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, - {"helix": 7, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 1, "forward": true, "start": 8, "end": 24}, - {"helix": 0, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 3, "forward": true, "start": 8, "end": 24}, - {"helix": 2, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 5, "forward": true, "start": 8, "end": 24}, - {"helix": 4, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 7, "forward": true, "start": 8, "end": 24}, - {"helix": 6, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 13, "forward": true, "start": 8, "end": 24}, - {"helix": 12, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 15, "forward": true, "start": 8, "end": 24}, - {"helix": 14, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 9, "forward": true, "start": 8, "end": 24}, - {"helix": 8, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 11, "forward": true, "start": 8, "end": 24}, - {"helix": 10, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 21, "forward": true, "start": 8, "end": 24}, - {"helix": 20, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 23, "forward": true, "start": 8, "end": 24}, - {"helix": 22, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 17, "forward": true, "start": 8, "end": 24}, - {"helix": 16, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 19, "forward": true, "start": 8, "end": 24}, - {"helix": 18, "forward": false, "start": 8, "end": 24} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 0, "forward": false, "start": 280, "end": 296}, - {"helix": 1, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 2, "forward": false, "start": 280, "end": 296}, - {"helix": 3, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 4, "forward": false, "start": 280, "end": 296}, - {"helix": 5, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 6, "forward": false, "start": 280, "end": 296}, - {"helix": 7, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 12, "forward": false, "start": 280, "end": 296}, - {"helix": 13, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 14, "forward": false, "start": 280, "end": 296}, - {"helix": 15, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 8, "forward": false, "start": 280, "end": 296}, - {"helix": 9, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 10, "forward": false, "start": 280, "end": 296}, - {"helix": 11, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 20, "forward": false, "start": 280, "end": 296}, - {"helix": 21, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 22, "forward": false, "start": 280, "end": 296}, - {"helix": 23, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 16, "forward": false, "start": 280, "end": 296}, - {"helix": 17, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 18, "forward": false, "start": 280, "end": 296}, - {"helix": 19, "forward": true, "start": 280, "end": 296} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 1, "forward": true, "start": 160, "end": 168}, - {"helix": 2, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 2, "forward": false, "start": 136, "end": 144}, - {"helix": 1, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 3, "forward": true, "start": 160, "end": 168}, - {"helix": 4, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 4, "forward": false, "start": 136, "end": 144}, - {"helix": 3, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 7, "forward": true, "start": 160, "end": 168}, - {"helix": 8, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 8, "forward": false, "start": 136, "end": 144}, - {"helix": 7, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 5, "forward": true, "start": 160, "end": 168}, - {"helix": 6, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 6, "forward": false, "start": 136, "end": 144}, - {"helix": 5, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 14, "forward": false, "start": 136, "end": 144}, - {"helix": 13, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 9, "forward": true, "start": 160, "end": 168}, - {"helix": 10, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 10, "forward": false, "start": 136, "end": 144}, - {"helix": 9, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 11, "forward": true, "start": 160, "end": 168}, - {"helix": 12, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 12, "forward": false, "start": 136, "end": 144}, - {"helix": 11, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 15, "forward": true, "start": 160, "end": 168}, - {"helix": 16, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 16, "forward": false, "start": 136, "end": 144}, - {"helix": 15, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 13, "forward": true, "start": 160, "end": 168}, - {"helix": 14, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 20, "forward": false, "start": 136, "end": 144}, - {"helix": 19, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 17, "forward": true, "start": 160, "end": 168}, - {"helix": 18, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 18, "forward": false, "start": 136, "end": 144}, - {"helix": 17, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 21, "forward": true, "start": 160, "end": 168}, - {"helix": 22, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 22, "forward": false, "start": 136, "end": 144}, - {"helix": 21, "forward": true, "start": 136, "end": 160} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 19, "forward": true, "start": 160, "end": 168}, - {"helix": 20, "forward": false, "start": 144, "end": 168} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 0, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 1, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 2, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 2, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 3, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 4, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 4, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 5, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 6, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 6, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 7, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 8, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 12, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 13, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 14, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 14, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 15, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 16, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 8, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 9, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 10, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 10, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 11, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 12, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 18, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 19, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 20, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 20, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 21, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 22, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 16, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 17, "forward": true, "start": 24, "end": 40, "deletions": [27]}, - {"helix": 18, "forward": false, "start": 32, "end": 40} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 3, "forward": true, "start": 48, "end": 56}, - {"helix": 2, "forward": false, "start": 40, "end": 56}, - {"helix": 1, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 5, "forward": true, "start": 48, "end": 56}, - {"helix": 4, "forward": false, "start": 40, "end": 56}, - {"helix": 3, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 7, "forward": true, "start": 48, "end": 56}, - {"helix": 6, "forward": false, "start": 40, "end": 56}, - {"helix": 5, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 9, "forward": true, "start": 48, "end": 56}, - {"helix": 8, "forward": false, "start": 40, "end": 56}, - {"helix": 7, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 15, "forward": true, "start": 48, "end": 56}, - {"helix": 14, "forward": false, "start": 40, "end": 56}, - {"helix": 13, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 17, "forward": true, "start": 48, "end": 56}, - {"helix": 16, "forward": false, "start": 40, "end": 56}, - {"helix": 15, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 11, "forward": true, "start": 48, "end": 56}, - {"helix": 10, "forward": false, "start": 40, "end": 56}, - {"helix": 9, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 13, "forward": true, "start": 48, "end": 56}, - {"helix": 12, "forward": false, "start": 40, "end": 56}, - {"helix": 11, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 21, "forward": true, "start": 48, "end": 56}, - {"helix": 20, "forward": false, "start": 40, "end": 56}, - {"helix": 19, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 23, "forward": true, "start": 48, "end": 56}, - {"helix": 22, "forward": false, "start": 40, "end": 56}, - {"helix": 21, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 19, "forward": true, "start": 48, "end": 56}, - {"helix": 18, "forward": false, "start": 40, "end": 56}, - {"helix": 17, "forward": true, "start": 40, "end": 48} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 1, "forward": true, "start": 48, "end": 56}, - {"helix": 0, "forward": false, "start": 32, "end": 56} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 22, "forward": false, "start": 24, "end": 32, "deletions": [27]}, - {"helix": 23, "forward": true, "start": 24, "end": 48, "deletions": [27]} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 0, "forward": false, "start": 56, "end": 64}, - {"helix": 1, "forward": true, "start": 56, "end": 72}, - {"helix": 2, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 2, "forward": false, "start": 56, "end": 64}, - {"helix": 3, "forward": true, "start": 56, "end": 72}, - {"helix": 4, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 4, "forward": false, "start": 56, "end": 64}, - {"helix": 5, "forward": true, "start": 56, "end": 72}, - {"helix": 6, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 6, "forward": false, "start": 56, "end": 64}, - {"helix": 7, "forward": true, "start": 56, "end": 72}, - {"helix": 8, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 12, "forward": false, "start": 56, "end": 64}, - {"helix": 13, "forward": true, "start": 56, "end": 72}, - {"helix": 14, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 14, "forward": false, "start": 56, "end": 64}, - {"helix": 15, "forward": true, "start": 56, "end": 72}, - {"helix": 16, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 8, "forward": false, "start": 56, "end": 64}, - {"helix": 9, "forward": true, "start": 56, "end": 72}, - {"helix": 10, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 10, "forward": false, "start": 56, "end": 64}, - {"helix": 11, "forward": true, "start": 56, "end": 72}, - {"helix": 12, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 18, "forward": false, "start": 56, "end": 64}, - {"helix": 19, "forward": true, "start": 56, "end": 72}, - {"helix": 20, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 20, "forward": false, "start": 56, "end": 64}, - {"helix": 21, "forward": true, "start": 56, "end": 72}, - {"helix": 22, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 16, "forward": false, "start": 56, "end": 64}, - {"helix": 17, "forward": true, "start": 56, "end": 72}, - {"helix": 18, "forward": false, "start": 64, "end": 72} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 3, "forward": true, "start": 80, "end": 88}, - {"helix": 2, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 1, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 5, "forward": true, "start": 80, "end": 88}, - {"helix": 4, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 3, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 7, "forward": true, "start": 80, "end": 88}, - {"helix": 6, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 5, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 9, "forward": true, "start": 80, "end": 88}, - {"helix": 8, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 7, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 15, "forward": true, "start": 80, "end": 88}, - {"helix": 14, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 13, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 17, "forward": true, "start": 80, "end": 88}, - {"helix": 16, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 15, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 11, "forward": true, "start": 80, "end": 88}, - {"helix": 10, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 9, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 13, "forward": true, "start": 80, "end": 88}, - {"helix": 12, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 11, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 21, "forward": true, "start": 80, "end": 88}, - {"helix": 20, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 19, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 23, "forward": true, "start": 80, "end": 88}, - {"helix": 22, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 21, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 19, "forward": true, "start": 80, "end": 88}, - {"helix": 18, "forward": false, "start": 72, "end": 88, "deletions": [75]}, - {"helix": 17, "forward": true, "start": 72, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 1, "forward": true, "start": 80, "end": 88}, - {"helix": 0, "forward": false, "start": 64, "end": 88, "deletions": [75]} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 22, "forward": false, "start": 56, "end": 64}, - {"helix": 23, "forward": true, "start": 56, "end": 80, "deletions": [75]} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 0, "forward": false, "start": 88, "end": 96}, - {"helix": 1, "forward": true, "start": 88, "end": 104}, - {"helix": 2, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 2, "forward": false, "start": 88, "end": 96}, - {"helix": 3, "forward": true, "start": 88, "end": 104}, - {"helix": 4, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 4, "forward": false, "start": 88, "end": 96}, - {"helix": 5, "forward": true, "start": 88, "end": 104}, - {"helix": 6, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 6, "forward": false, "start": 88, "end": 96}, - {"helix": 7, "forward": true, "start": 88, "end": 104}, - {"helix": 8, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 12, "forward": false, "start": 88, "end": 96}, - {"helix": 13, "forward": true, "start": 88, "end": 104}, - {"helix": 14, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 14, "forward": false, "start": 88, "end": 96}, - {"helix": 15, "forward": true, "start": 88, "end": 104}, - {"helix": 16, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 8, "forward": false, "start": 88, "end": 96}, - {"helix": 9, "forward": true, "start": 88, "end": 104}, - {"helix": 10, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 10, "forward": false, "start": 88, "end": 96}, - {"helix": 11, "forward": true, "start": 88, "end": 104}, - {"helix": 12, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 18, "forward": false, "start": 88, "end": 96}, - {"helix": 19, "forward": true, "start": 88, "end": 104}, - {"helix": 20, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 20, "forward": false, "start": 88, "end": 96}, - {"helix": 21, "forward": true, "start": 88, "end": 104}, - {"helix": 22, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 16, "forward": false, "start": 88, "end": 96}, - {"helix": 17, "forward": true, "start": 88, "end": 104}, - {"helix": 18, "forward": false, "start": 96, "end": 104} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 3, "forward": true, "start": 112, "end": 120}, - {"helix": 2, "forward": false, "start": 104, "end": 120}, - {"helix": 1, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 5, "forward": true, "start": 112, "end": 120}, - {"helix": 4, "forward": false, "start": 104, "end": 120}, - {"helix": 3, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 7, "forward": true, "start": 112, "end": 120}, - {"helix": 6, "forward": false, "start": 104, "end": 120}, - {"helix": 5, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 9, "forward": true, "start": 112, "end": 120}, - {"helix": 8, "forward": false, "start": 104, "end": 120}, - {"helix": 7, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 15, "forward": true, "start": 112, "end": 120}, - {"helix": 14, "forward": false, "start": 104, "end": 120}, - {"helix": 13, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 17, "forward": true, "start": 112, "end": 120}, - {"helix": 16, "forward": false, "start": 104, "end": 120}, - {"helix": 15, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 11, "forward": true, "start": 112, "end": 120}, - {"helix": 10, "forward": false, "start": 104, "end": 120}, - {"helix": 9, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 13, "forward": true, "start": 112, "end": 120}, - {"helix": 12, "forward": false, "start": 104, "end": 120}, - {"helix": 11, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 21, "forward": true, "start": 112, "end": 120}, - {"helix": 20, "forward": false, "start": 104, "end": 120}, - {"helix": 19, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 23, "forward": true, "start": 112, "end": 120}, - {"helix": 22, "forward": false, "start": 104, "end": 120}, - {"helix": 21, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 19, "forward": true, "start": 112, "end": 120}, - {"helix": 18, "forward": false, "start": 104, "end": 120}, - {"helix": 17, "forward": true, "start": 104, "end": 112} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 1, "forward": true, "start": 112, "end": 120}, - {"helix": 0, "forward": false, "start": 96, "end": 120} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 22, "forward": false, "start": 88, "end": 96}, - {"helix": 23, "forward": true, "start": 88, "end": 112} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 0, "forward": false, "start": 184, "end": 192}, - {"helix": 1, "forward": true, "start": 184, "end": 200}, - {"helix": 2, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 2, "forward": false, "start": 184, "end": 192}, - {"helix": 3, "forward": true, "start": 184, "end": 200}, - {"helix": 4, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 4, "forward": false, "start": 184, "end": 192}, - {"helix": 5, "forward": true, "start": 184, "end": 200}, - {"helix": 6, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 6, "forward": false, "start": 184, "end": 192}, - {"helix": 7, "forward": true, "start": 184, "end": 200}, - {"helix": 8, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 12, "forward": false, "start": 184, "end": 192}, - {"helix": 13, "forward": true, "start": 184, "end": 200}, - {"helix": 14, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 14, "forward": false, "start": 184, "end": 192}, - {"helix": 15, "forward": true, "start": 184, "end": 200}, - {"helix": 16, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 8, "forward": false, "start": 184, "end": 192}, - {"helix": 9, "forward": true, "start": 184, "end": 200}, - {"helix": 10, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 10, "forward": false, "start": 184, "end": 192}, - {"helix": 11, "forward": true, "start": 184, "end": 200}, - {"helix": 12, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 18, "forward": false, "start": 184, "end": 192}, - {"helix": 19, "forward": true, "start": 184, "end": 200}, - {"helix": 20, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 20, "forward": false, "start": 184, "end": 192}, - {"helix": 21, "forward": true, "start": 184, "end": 200}, - {"helix": 22, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 16, "forward": false, "start": 184, "end": 192}, - {"helix": 17, "forward": true, "start": 184, "end": 200}, - {"helix": 18, "forward": false, "start": 192, "end": 200} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 3, "forward": true, "start": 208, "end": 216}, - {"helix": 2, "forward": false, "start": 200, "end": 216}, - {"helix": 1, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 5, "forward": true, "start": 208, "end": 216}, - {"helix": 4, "forward": false, "start": 200, "end": 216}, - {"helix": 3, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 7, "forward": true, "start": 208, "end": 216}, - {"helix": 6, "forward": false, "start": 200, "end": 216}, - {"helix": 5, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 9, "forward": true, "start": 208, "end": 216}, - {"helix": 8, "forward": false, "start": 200, "end": 216}, - {"helix": 7, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 15, "forward": true, "start": 208, "end": 216}, - {"helix": 14, "forward": false, "start": 200, "end": 216}, - {"helix": 13, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 17, "forward": true, "start": 208, "end": 216}, - {"helix": 16, "forward": false, "start": 200, "end": 216}, - {"helix": 15, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 11, "forward": true, "start": 208, "end": 216}, - {"helix": 10, "forward": false, "start": 200, "end": 216}, - {"helix": 9, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 13, "forward": true, "start": 208, "end": 216}, - {"helix": 12, "forward": false, "start": 200, "end": 216}, - {"helix": 11, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 21, "forward": true, "start": 208, "end": 216}, - {"helix": 20, "forward": false, "start": 200, "end": 216}, - {"helix": 19, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 23, "forward": true, "start": 208, "end": 216}, - {"helix": 22, "forward": false, "start": 200, "end": 216}, - {"helix": 21, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 19, "forward": true, "start": 208, "end": 216}, - {"helix": 18, "forward": false, "start": 200, "end": 216}, - {"helix": 17, "forward": true, "start": 200, "end": 208} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 1, "forward": true, "start": 208, "end": 216}, - {"helix": 0, "forward": false, "start": 192, "end": 216} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 22, "forward": false, "start": 184, "end": 192}, - {"helix": 23, "forward": true, "start": 184, "end": 208} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 0, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 1, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 2, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 2, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 3, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 4, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 4, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 5, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 6, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 6, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 7, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 8, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 12, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 13, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 14, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 14, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 15, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 16, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 8, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 9, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 10, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 10, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 11, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 12, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 18, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 19, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 20, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 20, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 21, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 22, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 16, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 17, "forward": true, "start": 216, "end": 232, "deletions": [219]}, - {"helix": 18, "forward": false, "start": 224, "end": 232} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 3, "forward": true, "start": 240, "end": 248}, - {"helix": 2, "forward": false, "start": 232, "end": 248}, - {"helix": 1, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 5, "forward": true, "start": 240, "end": 248}, - {"helix": 4, "forward": false, "start": 232, "end": 248}, - {"helix": 3, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 7, "forward": true, "start": 240, "end": 248}, - {"helix": 6, "forward": false, "start": 232, "end": 248}, - {"helix": 5, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 9, "forward": true, "start": 240, "end": 248}, - {"helix": 8, "forward": false, "start": 232, "end": 248}, - {"helix": 7, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 15, "forward": true, "start": 240, "end": 248}, - {"helix": 14, "forward": false, "start": 232, "end": 248}, - {"helix": 13, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 17, "forward": true, "start": 240, "end": 248}, - {"helix": 16, "forward": false, "start": 232, "end": 248}, - {"helix": 15, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 11, "forward": true, "start": 240, "end": 248}, - {"helix": 10, "forward": false, "start": 232, "end": 248}, - {"helix": 9, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 13, "forward": true, "start": 240, "end": 248}, - {"helix": 12, "forward": false, "start": 232, "end": 248}, - {"helix": 11, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 21, "forward": true, "start": 240, "end": 248}, - {"helix": 20, "forward": false, "start": 232, "end": 248}, - {"helix": 19, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 23, "forward": true, "start": 240, "end": 248}, - {"helix": 22, "forward": false, "start": 232, "end": 248}, - {"helix": 21, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 19, "forward": true, "start": 240, "end": 248}, - {"helix": 18, "forward": false, "start": 232, "end": 248}, - {"helix": 17, "forward": true, "start": 232, "end": 240} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 1, "forward": true, "start": 240, "end": 248}, - {"helix": 0, "forward": false, "start": 224, "end": 248} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 22, "forward": false, "start": 216, "end": 224, "deletions": [219]}, - {"helix": 23, "forward": true, "start": 216, "end": 240, "deletions": [219]} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 0, "forward": false, "start": 248, "end": 256}, - {"helix": 1, "forward": true, "start": 248, "end": 264}, - {"helix": 2, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 2, "forward": false, "start": 248, "end": 256}, - {"helix": 3, "forward": true, "start": 248, "end": 264}, - {"helix": 4, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 4, "forward": false, "start": 248, "end": 256}, - {"helix": 5, "forward": true, "start": 248, "end": 264}, - {"helix": 6, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 6, "forward": false, "start": 248, "end": 256}, - {"helix": 7, "forward": true, "start": 248, "end": 264}, - {"helix": 8, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 12, "forward": false, "start": 248, "end": 256}, - {"helix": 13, "forward": true, "start": 248, "end": 264}, - {"helix": 14, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 14, "forward": false, "start": 248, "end": 256}, - {"helix": 15, "forward": true, "start": 248, "end": 264}, - {"helix": 16, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 8, "forward": false, "start": 248, "end": 256}, - {"helix": 9, "forward": true, "start": 248, "end": 264}, - {"helix": 10, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 10, "forward": false, "start": 248, "end": 256}, - {"helix": 11, "forward": true, "start": 248, "end": 264}, - {"helix": 12, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 18, "forward": false, "start": 248, "end": 256}, - {"helix": 19, "forward": true, "start": 248, "end": 264}, - {"helix": 20, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 20, "forward": false, "start": 248, "end": 256}, - {"helix": 21, "forward": true, "start": 248, "end": 264}, - {"helix": 22, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 16, "forward": false, "start": 248, "end": 256}, - {"helix": 17, "forward": true, "start": 248, "end": 264}, - {"helix": 18, "forward": false, "start": 256, "end": 264} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 3, "forward": true, "start": 272, "end": 280}, - {"helix": 2, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 1, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 5, "forward": true, "start": 272, "end": 280}, - {"helix": 4, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 3, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 7, "forward": true, "start": 272, "end": 280}, - {"helix": 6, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 5, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 9, "forward": true, "start": 272, "end": 280}, - {"helix": 8, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 7, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 15, "forward": true, "start": 272, "end": 280}, - {"helix": 14, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 13, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 17, "forward": true, "start": 272, "end": 280}, - {"helix": 16, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 15, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 11, "forward": true, "start": 272, "end": 280}, - {"helix": 10, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 9, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 13, "forward": true, "start": 272, "end": 280}, - {"helix": 12, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 11, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 21, "forward": true, "start": 272, "end": 280}, - {"helix": 20, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 19, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 23, "forward": true, "start": 272, "end": 280}, - {"helix": 22, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 21, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 19, "forward": true, "start": 272, "end": 280}, - {"helix": 18, "forward": false, "start": 264, "end": 280, "deletions": [267]}, - {"helix": 17, "forward": true, "start": 264, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 1, "forward": true, "start": 272, "end": 280}, - {"helix": 0, "forward": false, "start": 256, "end": 280, "deletions": [267]} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 22, "forward": false, "start": 248, "end": 256}, - {"helix": 23, "forward": true, "start": 248, "end": 272, "deletions": [267]} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 0, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 1, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 2, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 2, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 3, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 4, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 4, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 5, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 6, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 6, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 7, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 8, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 12, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 13, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 14, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 14, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 15, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 16, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 8, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 9, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 10, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 10, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 11, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 12, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 18, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 19, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 20, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 20, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 21, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 22, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#03b6a2", - "substrands": [ - {"helix": 16, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 17, "forward": true, "start": 120, "end": 136, "deletions": [123]}, - {"helix": 18, "forward": false, "start": 128, "end": 136} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 3, "forward": true, "start": 176, "end": 184}, - {"helix": 2, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 1, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 5, "forward": true, "start": 176, "end": 184}, - {"helix": 4, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 3, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 7, "forward": true, "start": 176, "end": 184}, - {"helix": 6, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 5, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#333333", - "substrands": [ - {"helix": 9, "forward": true, "start": 176, "end": 184}, - {"helix": 8, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 7, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#7300de", - "substrands": [ - {"helix": 15, "forward": true, "start": 176, "end": 184}, - {"helix": 14, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 13, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#888888", - "substrands": [ - {"helix": 17, "forward": true, "start": 176, "end": 184}, - {"helix": 16, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 15, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#cc0000", - "substrands": [ - {"helix": 11, "forward": true, "start": 176, "end": 184}, - {"helix": 10, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 9, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#32b86c", - "substrands": [ - {"helix": 13, "forward": true, "start": 176, "end": 184}, - {"helix": 12, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 11, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#f74308", - "substrands": [ - {"helix": 21, "forward": true, "start": 176, "end": 184}, - {"helix": 20, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 19, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#57bb00", - "substrands": [ - {"helix": 23, "forward": true, "start": 176, "end": 184}, - {"helix": 22, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 21, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#007200", - "substrands": [ - {"helix": 19, "forward": true, "start": 176, "end": 184}, - {"helix": 18, "forward": false, "start": 168, "end": 184, "deletions": [171]}, - {"helix": 17, "forward": true, "start": 168, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#aaaa00", - "substrands": [ - {"helix": 22, "forward": false, "start": 120, "end": 128, "deletions": [123]}, - {"helix": 23, "forward": true, "start": 120, "end": 144, "deletions": [123]} - ] - }, - { - "color": "#f7931e", - "substrands": [ - {"helix": 23, "forward": true, "start": 144, "end": 176, "deletions": [171]} - ] - }, - { - "color": "#320096", - "substrands": [ - {"helix": 0, "forward": false, "start": 128, "end": 160} - ] - }, - { - "color": "#b8056c", - "substrands": [ - {"helix": 1, "forward": true, "start": 176, "end": 184}, - {"helix": 0, "forward": false, "start": 160, "end": 184, "deletions": [171]} - ] - } - ] +{ + "version": "0.1.0", + "helices": [ + {"grid_position": [0, -3], "max_offset": 304}, + {"grid_position": [0, -2], "max_offset": 304}, + {"grid_position": [0, -1], "max_offset": 304}, + {"grid_position": [0, 0], "max_offset": 304}, + {"grid_position": [0, 1], "max_offset": 304}, + {"grid_position": [0, 2], "max_offset": 304}, + {"grid_position": [0, 3], "max_offset": 304}, + {"grid_position": [0, 4], "max_offset": 304}, + {"grid_position": [0, 5], "max_offset": 304}, + {"grid_position": [0, 6], "max_offset": 304}, + {"grid_position": [0, 7], "max_offset": 304}, + {"grid_position": [0, 8], "max_offset": 304}, + {"grid_position": [0, 9], "max_offset": 304}, + {"grid_position": [0, 10], "max_offset": 304}, + {"grid_position": [0, 11], "max_offset": 304}, + {"grid_position": [0, 12], "max_offset": 304}, + {"grid_position": [0, 13], "max_offset": 304}, + {"grid_position": [0, 14], "max_offset": 304}, + {"grid_position": [0, 15], "max_offset": 304}, + {"grid_position": [0, 16], "max_offset": 304}, + {"grid_position": [0, 17], "max_offset": 304}, + {"grid_position": [0, 18], "max_offset": 304}, + {"grid_position": [0, 19], "max_offset": 304}, + {"grid_position": [0, 20], "max_offset": 304} + ], + "strands": [ + { + "color": "#cc0000", + "dna_sequence": "TCACGTTGAAAATCTCGCGAATAATAATTTTT", + "substrands": [ + {"helix": 1, "forward": true, "start": 8, "end": 24}, + {"helix": 0, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#f74308", + "dna_sequence": "AGGAAGTTTCCATTAATAAAGACTTTTTCATG", + "substrands": [ + {"helix": 3, "forward": true, "start": 8, "end": 24}, + {"helix": 2, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "CAGGCGCATAGGCTGGTGAACGGTGTACAGAC", + "substrands": [ + {"helix": 5, "forward": true, "start": 8, "end": 24}, + {"helix": 4, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#007200", + "dna_sequence": "GGTAGAAAGATTCATCGAACAACATTATTACA", + "substrands": [ + {"helix": 7, "forward": true, "start": 8, "end": 24}, + {"helix": 6, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "TTTTGCGGGAGAAGCCTATGACCCTGTAATAC", + "substrands": [ + {"helix": 13, "forward": true, "start": 8, "end": 24}, + {"helix": 12, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "GTCAATCATATGTACCATCGTAAAACTAGCAT", + "substrands": [ + {"helix": 15, "forward": true, "start": 8, "end": 24}, + {"helix": 14, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "TGACCATAAATCAAAAGTTCAGAAAACGAGAA", + "substrands": [ + {"helix": 9, "forward": true, "start": 8, "end": 24}, + {"helix": 8, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#320096", + "dna_sequence": "GTGTCTGGAAGTTTCAATGCAACTAAAGTACG", + "substrands": [ + {"helix": 11, "forward": true, "start": 8, "end": 24}, + {"helix": 10, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "TATTGGGCGCCAGGGTGGAGAGGCGGTTTGCG", + "substrands": [ + {"helix": 21, "forward": true, "start": 8, "end": 24}, + {"helix": 20, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#333333", + "dna_sequence": "TGGCCCACTACGTGAACCGTCTATCAGGGCGA", + "substrands": [ + {"helix": 23, "forward": true, "start": 8, "end": 24}, + {"helix": 22, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#7300de", + "dna_sequence": "GTGTAGATGGGCGCATGGGATAGGTCACGTTG", + "substrands": [ + {"helix": 17, "forward": true, "start": 8, "end": 24}, + {"helix": 16, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#888888", + "dna_sequence": "AGTGCCAAGCTTGCATTTGTAAAACGACGGCC", + "substrands": [ + {"helix": 19, "forward": true, "start": 8, "end": 24}, + {"helix": 18, "forward": false, "start": 8, "end": 24} + ] + }, + { + "color": "#f74308", + "dna_sequence": "CAGAACCGCCACCCTCTCAGAACCGCCACCCT", + "substrands": [ + {"helix": 0, "forward": false, "start": 280, "end": 296}, + {"helix": 1, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "ATACAGGAGTGTACTGTACATGGCTTTTGATG", + "substrands": [ + {"helix": 2, "forward": false, "start": 280, "end": 296}, + {"helix": 3, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "CGTTTGCCATCTTTTCATAGCCCCCTTATTAG", + "substrands": [ + {"helix": 4, "forward": false, "start": 280, "end": 296}, + {"helix": 5, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "CAAAGACAAAAGGGCGTATGGTTTACCAGCGC", + "substrands": [ + {"helix": 6, "forward": false, "start": 280, "end": 296}, + {"helix": 7, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#320096", + "dna_sequence": "TATCCCATCCTAATTTTGAACAAGAAAAATAA", + "substrands": [ + {"helix": 12, "forward": false, "start": 280, "end": 296}, + {"helix": 13, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "CATAATTACTAGAAAAGAATAAACACCGGAAT", + "substrands": [ + {"helix": 14, "forward": false, "start": 280, "end": 296}, + {"helix": 15, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#333333", + "dna_sequence": "AGAGCAAGAAACAATGGTTAAGCCCAATAATA", + "substrands": [ + {"helix": 8, "forward": false, "start": 280, "end": 296}, + {"helix": 9, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#7300de", + "dna_sequence": "CAATTTTATCCTGAATATTTTGCACCCAGCTA", + "substrands": [ + {"helix": 10, "forward": false, "start": 280, "end": 296}, + {"helix": 11, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#888888", + "dna_sequence": "AGACTTTACAAACAATAGGATTTAGAAGTATT", + "substrands": [ + {"helix": 20, "forward": false, "start": 280, "end": 296}, + {"helix": 21, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "AAAAATACCGAACGAACTAAAACATCGCCATT", + "substrands": [ + {"helix": 22, "forward": false, "start": 280, "end": 296}, + {"helix": 23, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "AATCCTTGAAAACATAATTAATTTTCCCTTAG", + "substrands": [ + {"helix": 16, "forward": false, "start": 280, "end": 296}, + {"helix": 17, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#f74308", + "dna_sequence": "AGATGAATATACAGTATTTCAGGTTTAACGTC", + "substrands": [ + {"helix": 18, "forward": false, "start": 280, "end": 296}, + {"helix": 19, "forward": true, "start": 280, "end": 296} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "TTAGGATTGGCTGAGACTCCTCAATAACCGAT", + "substrands": [ + {"helix": 1, "forward": true, "start": 160, "end": 168}, + {"helix": 2, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "ATATTCGGAACCATCGCCCACGCAGAGAAGGA", + "substrands": [ + {"helix": 2, "forward": false, "start": 136, "end": 144}, + {"helix": 1, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "TTGACAGGCCACCACCAGAGCCGCGATTTGTA", + "substrands": [ + {"helix": 3, "forward": true, "start": 160, "end": 168}, + {"helix": 4, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#320096", + "dna_sequence": "TCATCGCCAACAAAGTACAACGGACGCCAGCA", + "substrands": [ + {"helix": 4, "forward": false, "start": 136, "end": 144}, + {"helix": 3, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "TTATTACGAAGAACTGGCATGATTGCGAGAGG", + "substrands": [ + {"helix": 7, "forward": true, "start": 160, "end": 168}, + {"helix": 8, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#333333", + "dna_sequence": "CTTTTGCAGATAAAAACCAAAATAAAGACTCC", + "substrands": [ + {"helix": 8, "forward": false, "start": 136, "end": 144}, + {"helix": 7, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#7300de", + "dna_sequence": "GCAAGGCCTCACCAGTAGCACCATGGGCTTGA", + "substrands": [ + {"helix": 5, "forward": true, "start": 160, "end": 168}, + {"helix": 6, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#888888", + "dna_sequence": "GATGGTTTGAACGAGTAGTAAATTTACCATTA", + "substrands": [ + {"helix": 6, "forward": false, "start": 136, "end": 144}, + {"helix": 5, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "CAACCGTTTCAAATCACCATCAATTCGAGCCA", + "substrands": [ + {"helix": 14, "forward": false, "start": 136, "end": 144}, + {"helix": 13, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "AGAGAGAAAAAAATGAAAATAGCAAGCAAACT", + "substrands": [ + {"helix": 9, "forward": true, "start": 160, "end": 168}, + {"helix": 10, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#f74308", + "dna_sequence": "CCAACAGGAGCGAACCAGACCGGAGCCTTTAC", + "substrands": [ + {"helix": 10, "forward": false, "start": 136, "end": 144}, + {"helix": 9, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "CCAATAGCTCATCGTAGGAATCATGGCATCAA", + "substrands": [ + {"helix": 11, "forward": true, "start": 160, "end": 168}, + {"helix": 12, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#007200", + "dna_sequence": "TTCTACTACGCGAGCTGAAAAGGTTACCGCGC", + "substrands": [ + {"helix": 12, "forward": false, "start": 136, "end": 144}, + {"helix": 11, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "ATCGCAAGTATGTAAATGCTGATGATAGGAAC", + "substrands": [ + {"helix": 15, "forward": true, "start": 160, "end": 168}, + {"helix": 16, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "GCCATCAAGCTCATTTTTTAACCACAAATCCA", + "substrands": [ + {"helix": 16, "forward": false, "start": 136, "end": 144}, + {"helix": 15, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "GTAATAAGTTAGGCAGAGGCATTTATGATATT", + "substrands": [ + {"helix": 13, "forward": true, "start": 160, "end": 168}, + {"helix": 14, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#320096", + "dna_sequence": "AAGCCTGGTACGAGCCGGAAGCATAGATGATG", + "substrands": [ + {"helix": 20, "forward": false, "start": 136, "end": 144}, + {"helix": 19, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "AGAAAACAAAGAAGATGATGAAACAGGCTGCG", + "substrands": [ + {"helix": 17, "forward": true, "start": 160, "end": 168}, + {"helix": 18, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#333333", + "dna_sequence": "CAACTGTTGCGCCATTCGCCATTCAAACATCA", + "substrands": [ + {"helix": 18, "forward": false, "start": 136, "end": 144}, + {"helix": 17, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#7300de", + "dna_sequence": "TCAATATCGAACCTCAAATATCAATTCCGAAA", + "substrands": [ + {"helix": 21, "forward": true, "start": 160, "end": 168}, + {"helix": 22, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#888888", + "dna_sequence": "TCGGCAAATCCTGTTTGATGGTGGACCCTCAA", + "substrands": [ + {"helix": 22, "forward": false, "start": 136, "end": 144}, + {"helix": 21, "forward": true, "start": 136, "end": 160} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "GCAATTCACATATTCCTGATTATCAAAGTGTA", + "substrands": [ + {"helix": 19, "forward": true, "start": 160, "end": 168}, + {"helix": 20, "forward": false, "start": 144, "end": 168} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "AGGAATTCAAAAAAAAGGCTCCAGAGGCTT", + "substrands": [ + {"helix": 0, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 1, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 2, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#007200", + "dna_sequence": "TGAGGACACGGGTAAAATACGTTTGAAAGA", + "substrands": [ + {"helix": 2, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 3, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 4, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "GGACAGACTGACCTTCATCAAGTAAAACGA", + "substrands": [ + {"helix": 4, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 5, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 6, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "ACTAACGAGTTGAGATTTAGGACAAATGCT", + "substrands": [ + {"helix": 6, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 7, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 8, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "AAAACATTTTATTTCAACGCAAAATCGATG", + "substrands": [ + {"helix": 12, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 13, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 14, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#320096", + "dna_sequence": "AACGGTACCGGTTGATAATCAGCGGATTGA", + "substrands": [ + {"helix": 14, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 15, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 16, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "TTAAACAATCAGGTCTTTACCCCAACATGT", + "substrands": [ + {"helix": 8, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 9, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 10, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#333333", + "dna_sequence": "TTTAAATTTCCATATAACAGTTTTGTACCA", + "substrands": [ + {"helix": 10, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 11, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 12, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#7300de", + "dna_sequence": "CACGACGGCCTGCAGGTCGACTTCGGCCAA", + "substrands": [ + {"helix": 18, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 19, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 20, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#888888", + "dna_sequence": "CGCGCGGGGTTTTTCTTTTCACTCAAAGGG", + "substrands": [ + {"helix": 20, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 21, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 22, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "CCGTAATCGTAACCGTGCATCTTTCCCAGT", + "substrands": [ + {"helix": 16, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 17, "forward": true, "start": 24, "end": 40, "deletions": [27]}, + {"helix": 18, "forward": false, "start": 32, "end": 40} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "TACGAAGGGGGTAGCAACGGCTACAAAAGGAG", + "substrands": [ + {"helix": 3, "forward": true, "start": 48, "end": 56}, + {"helix": 2, "forward": false, "start": 40, "end": 56}, + {"helix": 1, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#f74308", + "dna_sequence": "TGACAAGAACCGAACTGACCAACTAATGCCAC", + "substrands": [ + {"helix": 5, "forward": true, "start": 48, "end": 56}, + {"helix": 4, "forward": false, "start": 40, "end": 56}, + {"helix": 3, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "TTCAACTAGAAAAATCTACGTTAAAGTAATCT", + "substrands": [ + {"helix": 7, "forward": true, "start": 48, "end": 56}, + {"helix": 6, "forward": false, "start": 40, "end": 56}, + {"helix": 5, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#007200", + "dna_sequence": "ATAGTCAGTTCATTGAATCCCCCTATACCACA", + "substrands": [ + {"helix": 9, "forward": true, "start": 48, "end": 56}, + {"helix": 8, "forward": false, "start": 40, "end": 56}, + {"helix": 7, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "CAAAAACACTGGAGCAAACAAGAGGGATAAAA", + "substrands": [ + {"helix": 15, "forward": true, "start": 48, "end": 56}, + {"helix": 14, "forward": false, "start": 40, "end": 56}, + {"helix": 13, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "GAGGGGACCCGTGGGAACAAACGGAAAAGCCC", + "substrands": [ + {"helix": 17, "forward": true, "start": 48, "end": 56}, + {"helix": 16, "forward": false, "start": 40, "end": 56}, + {"helix": 15, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "ATTCTGCGATATAATGCTGTAGCTTGACTATT", + "substrands": [ + {"helix": 11, "forward": true, "start": 48, "end": 56}, + {"helix": 10, "forward": false, "start": 40, "end": 56}, + {"helix": 9, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#320096", + "dna_sequence": "ATTTTTAGCATAAAGCTAAATCGGGATTCCCA", + "substrands": [ + {"helix": 13, "forward": true, "start": 48, "end": 56}, + {"helix": 12, "forward": false, "start": 40, "end": 56}, + {"helix": 11, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "CGGGCAACCAGCTGCATTAATGAACTAGAGGA", + "substrands": [ + {"helix": 21, "forward": true, "start": 48, "end": 56}, + {"helix": 20, "forward": false, "start": 40, "end": 56}, + {"helix": 19, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#333333", + "dna_sequence": "GGGGTCGAAACGTGGACTCCAACGCAGTGAGA", + "substrands": [ + {"helix": 23, "forward": true, "start": 48, "end": 56}, + {"helix": 22, "forward": false, "start": 40, "end": 56}, + {"helix": 21, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#7300de", + "dna_sequence": "TCCCCGGGGGGTAACGCCAGGGTTGCCAGTTT", + "substrands": [ + {"helix": 19, "forward": true, "start": 48, "end": 56}, + {"helix": 18, "forward": false, "start": 40, "end": 56}, + {"helix": 17, "forward": true, "start": 40, "end": 48} + ] + }, + { + "color": "#f74308", + "dna_sequence": "CCTTTAATGTGAGAATAGAAAGGAACAACTAA", + "substrands": [ + {"helix": 1, "forward": true, "start": 48, "end": 56}, + {"helix": 0, "forward": false, "start": 32, "end": 56} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "CGAAAAACCATCACCCAAATCAAGTTTTTT", + "substrands": [ + {"helix": 22, "forward": false, "start": 24, "end": 32, "deletions": [27]}, + {"helix": 23, "forward": true, "start": 24, "end": 48, "deletions": [27]} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "TCAGCGGATGTATCGGTTTATCAGGACAGCAT", + "substrands": [ + {"helix": 0, "forward": false, "start": 56, "end": 64}, + {"helix": 1, "forward": true, "start": 56, "end": 72}, + {"helix": 2, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "CGGAACGACACCAACCTAAAACGAGGTCAATC", + "substrands": [ + {"helix": 2, "forward": false, "start": 56, "end": 64}, + {"helix": 3, "forward": true, "start": 56, "end": 72}, + {"helix": 4, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#320096", + "dna_sequence": "ATAAGGGAACCGGATATTCATTACGTCAGGAC", + "substrands": [ + {"helix": 4, "forward": false, "start": 56, "end": 64}, + {"helix": 5, "forward": true, "start": 56, "end": 72}, + {"helix": 6, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "GTTGGGAAATGCAGATACATAACGGGAATCGT", + "substrands": [ + {"helix": 6, "forward": false, "start": 56, "end": 64}, + {"helix": 7, "forward": true, "start": 56, "end": 72}, + {"helix": 8, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#333333", + "dna_sequence": "CCTCAGAGAACCCTCATATATTTTGTCATTGC", + "substrands": [ + {"helix": 12, "forward": false, "start": 56, "end": 64}, + {"helix": 13, "forward": true, "start": 56, "end": 72}, + {"helix": 14, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#7300de", + "dna_sequence": "CTGAGAGTGGAAGATTGTATAAGCCAACCCGT", + "substrands": [ + {"helix": 14, "forward": false, "start": 56, "end": 64}, + {"helix": 15, "forward": true, "start": 56, "end": 72}, + {"helix": 16, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#888888", + "dna_sequence": "CATAAATAAAGCAAAGCGGATTGCAGAGCTTA", + "substrands": [ + {"helix": 8, "forward": false, "start": 56, "end": 64}, + {"helix": 9, "forward": true, "start": 56, "end": 72}, + {"helix": 10, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "ATTGCTGAAACGAGTAGATTTAGTCAATAAAG", + "substrands": [ + {"helix": 10, "forward": false, "start": 56, "end": 64}, + {"helix": 11, "forward": true, "start": 56, "end": 72}, + {"helix": 12, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "ATTAAGTTTACCGAGCTCGAATTCGGGAAACC", + "substrands": [ + {"helix": 18, "forward": false, "start": 56, "end": 64}, + {"helix": 19, "forward": true, "start": 56, "end": 72}, + {"helix": 20, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#f74308", + "dna_sequence": "TGTCGTGCAGCTGATTGCCCTTCAGAGTCCAC", + "substrands": [ + {"helix": 20, "forward": false, "start": 56, "end": 64}, + {"helix": 21, "forward": true, "start": 56, "end": 72}, + {"helix": 22, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "CGGATTCTGACGACAGTATCGGCCGCAAGGCG", + "substrands": [ + {"helix": 16, "forward": false, "start": 56, "end": 64}, + {"helix": 17, "forward": true, "start": 56, "end": 72}, + {"helix": 18, "forward": false, "start": 64, "end": 72} + ] + }, + { + "color": "#007200", + "dna_sequence": "AAAAGAATCCCTCAGCAGCGAAACTTGCTT", + "substrands": [ + {"helix": 3, "forward": true, "start": 80, "end": 88}, + {"helix": 2, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 1, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "AACGTAACGAACGAGGCGCAGACAAGAGGC", + "substrands": [ + {"helix": 5, "forward": true, "start": 80, "end": 88}, + {"helix": 4, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 3, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "GAATTACGTGGCTCATTATACCACCAAATC", + "substrands": [ + {"helix": 7, "forward": true, "start": 80, "end": 88}, + {"helix": 6, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 5, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "AGATTAAGAGCGTCCAATACTGCCCAAAAG", + "substrands": [ + {"helix": 9, "forward": true, "start": 80, "end": 88}, + {"helix": 8, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 7, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#320096", + "dna_sequence": "TAAATTGTTACAAAGGCTATCAGAAATGCA", + "substrands": [ + {"helix": 15, "forward": true, "start": 80, "end": 88}, + {"helix": 14, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 13, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "GATCGCACAATGTGAGCGAGTAAAAATATT", + "substrands": [ + {"helix": 17, "forward": true, "start": 80, "end": 88}, + {"helix": 16, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 15, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#333333", + "dna_sequence": "TTAGATACTTTTGCGGATGGCTTATCAAAA", + "substrands": [ + {"helix": 11, "forward": true, "start": 80, "end": 88}, + {"helix": 10, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 9, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#7300de", + "dna_sequence": "ATGCCTGAATTAGCAAAATTAAGTTGACCA", + "substrands": [ + {"helix": 13, "forward": true, "start": 80, "end": 88}, + {"helix": 12, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 11, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#888888", + "dna_sequence": "GCCCTGAGGCCCGCTTTCCAGTCGTAATCA", + "substrands": [ + {"helix": 21, "forward": true, "start": 80, "end": 88}, + {"helix": 20, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 19, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "AACCCTAATCCAGTTTGGAACAACCGCCTG", + "substrands": [ + {"helix": 23, "forward": true, "start": 80, "end": 88}, + {"helix": 22, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 21, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "TGGTCATAAAAGGGGGATGTGCTTCAGGAA", + "substrands": [ + {"helix": 19, "forward": true, "start": 80, "end": 88}, + {"helix": 18, "forward": false, "start": 72, "end": 88, "deletions": [75]}, + {"helix": 17, "forward": true, "start": 72, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#f74308", + "dna_sequence": "TCGAGGTGTTGCTAAACAACTTTCAACAGTT", + "substrands": [ + {"helix": 1, "forward": true, "start": 80, "end": 88}, + {"helix": 0, "forward": false, "start": 64, "end": 88, "deletions": [75]} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "TATTAAAGGGTGCCGTAAAGCACTAAATCGG", + "substrands": [ + {"helix": 22, "forward": false, "start": 56, "end": 64}, + {"helix": 23, "forward": true, "start": 56, "end": 80, "deletions": [75]} + ] + }, + { + "color": "#007200", + "dna_sequence": "ATGGGATTAATTTCTTAAACAGCTTTTTGCGG", + "substrands": [ + {"helix": 0, "forward": false, "start": 88, "end": 96}, + {"helix": 1, "forward": true, "start": 88, "end": 104}, + {"helix": 2, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "GATCGTCAACACTAAAACACTCATCCATGTTA", + "substrands": [ + {"helix": 2, "forward": false, "start": 88, "end": 96}, + {"helix": 3, "forward": true, "start": 88, "end": 104}, + {"helix": 4, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "CTTAGCCGAAAGCTGCTCATTCAGATGCGATT", + "substrands": [ + {"helix": 4, "forward": false, "start": 88, "end": 96}, + {"helix": 5, "forward": true, "start": 88, "end": 104}, + {"helix": 6, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "TTAAGAACAGGCATAGTAAGAGCAAATGTTTA", + "substrands": [ + {"helix": 6, "forward": false, "start": 88, "end": 96}, + {"helix": 7, "forward": true, "start": 88, "end": 104}, + {"helix": 8, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#320096", + "dna_sequence": "GGCAAAGAGTAATGTGTAGGTAAACTATTTTT", + "substrands": [ + {"helix": 12, "forward": false, "start": 88, "end": 96}, + {"helix": 13, "forward": true, "start": 88, "end": 104}, + {"helix": 14, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "GAGAGATCAAACGTTAATATTTTGGCTTTCAT", + "substrands": [ + {"helix": 14, "forward": false, "start": 88, "end": 96}, + {"helix": 15, "forward": true, "start": 88, "end": 104}, + {"helix": 16, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#333333", + "dna_sequence": "GACTGGATAGGAAGCCCGAAAGACTTTGATAA", + "substrands": [ + {"helix": 8, "forward": false, "start": 88, "end": 96}, + {"helix": 9, "forward": true, "start": 88, "end": 104}, + {"helix": 10, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#7300de", + "dna_sequence": "GAGGTCATATTTCGCAAATGGTCAACAGGCAA", + "substrands": [ + {"helix": 10, "forward": false, "start": 88, "end": 96}, + {"helix": 11, "forward": true, "start": 88, "end": 104}, + {"helix": 12, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#888888", + "dna_sequence": "AGCTGGCGGCTGTTTCCTGTGTGATTGCGTTG", + "substrands": [ + {"helix": 18, "forward": false, "start": 88, "end": 96}, + {"helix": 19, "forward": true, "start": 88, "end": 104}, + {"helix": 20, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "CGCTCACTAGAGTTGCAGCAAGCGTAGGGTTG", + "substrands": [ + {"helix": 20, "forward": false, "start": 88, "end": 96}, + {"helix": 21, "forward": true, "start": 88, "end": 104}, + {"helix": 22, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "CAACATTATCCAGCCAGCTTTCCGATTACGCC", + "substrands": [ + {"helix": 16, "forward": false, "start": 88, "end": 96}, + {"helix": 17, "forward": true, "start": 88, "end": 104}, + {"helix": 18, "forward": false, "start": 96, "end": 104} + ] + }, + { + "color": "#f74308", + "dna_sequence": "CCCAGCGAGGGAGTTAAAGGCCGCTGATACCG", + "substrands": [ + {"helix": 3, "forward": true, "start": 112, "end": 120}, + {"helix": 2, "forward": false, "start": 104, "end": 120}, + {"helix": 1, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "GCTTGCCCAAATCCGCGACCTGCTCTTTGACC", + "substrands": [ + {"helix": 5, "forward": true, "start": 112, "end": 120}, + {"helix": 4, "forward": false, "start": 104, "end": 120}, + {"helix": 3, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#007200", + "dna_sequence": "ATAACCCTCATTGTGAATTACCTTTGAATAAG", + "substrands": [ + {"helix": 7, "forward": true, "start": 112, "end": 120}, + {"helix": 6, "forward": false, "start": 104, "end": 120}, + {"helix": 5, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "TCGCGTTTGAGGGGGTAATAGTAAACACTATC", + "substrands": [ + {"helix": 9, "forward": true, "start": 112, "end": 120}, + {"helix": 8, "forward": false, "start": 104, "end": 120}, + {"helix": 7, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "CGCATTAAATGCCGGAGAGGGTAGGATTCAAA", + "substrands": [ + {"helix": 15, "forward": true, "start": 112, "end": 120}, + {"helix": 14, "forward": false, "start": 104, "end": 120}, + {"helix": 13, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "TCTGGTGCGGCCTTCCTGTAGCCATTAAAATT", + "substrands": [ + {"helix": 17, "forward": true, "start": 112, "end": 120}, + {"helix": 16, "forward": false, "start": 104, "end": 120}, + {"helix": 15, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#320096", + "dna_sequence": "TTTAGCTAACCTTTAATTGCTCCTTTCAAATA", + "substrands": [ + {"helix": 11, "forward": true, "start": 112, "end": 120}, + {"helix": 10, "forward": false, "start": 104, "end": 120}, + {"helix": 9, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "AGGGTGAGACATCCAATAAATCATATAACCTG", + "substrands": [ + {"helix": 13, "forward": true, "start": 112, "end": 120}, + {"helix": 12, "forward": false, "start": 104, "end": 120}, + {"helix": 11, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#333333", + "dna_sequence": "TGGTTTGCAGCTAACTCACATTAAAATTGTTA", + "substrands": [ + {"helix": 21, "forward": true, "start": 112, "end": 120}, + {"helix": 20, "forward": false, "start": 104, "end": 120}, + {"helix": 19, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#7300de", + "dna_sequence": "ACGGGGAAAAAGAATAGCCCGAGAGTCCACGC", + "substrands": [ + {"helix": 23, "forward": true, "start": 112, "end": 120}, + {"helix": 22, "forward": false, "start": 104, "end": 120}, + {"helix": 21, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#888888", + "dna_sequence": "TCCGCTCATGCGGGCCTCTTCGCTGCACCGCT", + "substrands": [ + {"helix": 19, "forward": true, "start": 112, "end": 120}, + {"helix": 18, "forward": false, "start": 104, "end": 120}, + {"helix": 17, "forward": true, "start": 104, "end": 112} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "ATAGTTGCGACGTTAGTAAATGAATTTTCTGT", + "substrands": [ + {"helix": 1, "forward": true, "start": 112, "end": 120}, + {"helix": 0, "forward": false, "start": 96, "end": 120} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "AGTGTTGTAGGGAGCCCCCGATTTAGAGCTTG", + "substrands": [ + {"helix": 22, "forward": false, "start": 88, "end": 96}, + {"helix": 23, "forward": true, "start": 88, "end": 112} + ] + }, + { + "color": "#f74308", + "dna_sequence": "CAACGCCTAGTACCAGGCGGATAACCTATTAT", + "substrands": [ + {"helix": 0, "forward": false, "start": 184, "end": 192}, + {"helix": 1, "forward": true, "start": 184, "end": 200}, + {"helix": 2, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "TCTGAAACAGACGATTGGCCTTGAAGAGCCAC", + "substrands": [ + {"helix": 2, "forward": false, "start": 184, "end": 192}, + {"helix": 3, "forward": true, "start": 184, "end": 200}, + {"helix": 4, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#007200", + "dna_sequence": "CACCCTCAGAAACCATCGATAGCATTGAGCCA", + "substrands": [ + {"helix": 4, "forward": false, "start": 184, "end": 192}, + {"helix": 5, "forward": true, "start": 184, "end": 200}, + {"helix": 6, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "TTTGGGAACGTAGAAAATACATACCGAGGAAA", + "substrands": [ + {"helix": 6, "forward": false, "start": 184, "end": 192}, + {"helix": 7, "forward": true, "start": 184, "end": 200}, + {"helix": 8, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "GAACAAGCGACAAAAGGTAAAGTAATCGCCAT", + "substrands": [ + {"helix": 12, "forward": false, "start": 184, "end": 192}, + {"helix": 13, "forward": true, "start": 184, "end": 200}, + {"helix": 14, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "ATTTAACAAAACTTTTTCAAATATAACCTCCG", + "substrands": [ + {"helix": 14, "forward": false, "start": 184, "end": 192}, + {"helix": 15, "forward": true, "start": 184, "end": 200}, + {"helix": 16, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#320096", + "dna_sequence": "CGCAATAAGAAGCGCATTAGACGGCCAAATAA", + "substrands": [ + {"helix": 8, "forward": false, "start": 184, "end": 192}, + {"helix": 9, "forward": true, "start": 184, "end": 200}, + {"helix": 10, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "GAAACGATAGAAGGCTTATCCGGTCTCATCGA", + "substrands": [ + {"helix": 10, "forward": false, "start": 184, "end": 192}, + {"helix": 11, "forward": true, "start": 184, "end": 200}, + {"helix": 12, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#333333", + "dna_sequence": "ATTCATTTTTGTTTGGATTATACTAAGAAACC", + "substrands": [ + {"helix": 18, "forward": false, "start": 184, "end": 192}, + {"helix": 19, "forward": true, "start": 184, "end": 200}, + {"helix": 20, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#7300de", + "dna_sequence": "ACCAGAAGTCAACAGTTGAAAGGAGCAAATGA", + "substrands": [ + {"helix": 20, "forward": false, "start": 184, "end": 192}, + {"helix": 21, "forward": true, "start": 184, "end": 200}, + {"helix": 22, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#888888", + "dna_sequence": "GCTTAGGTAACAATTTCATTTGAAGGCGAATT", + "substrands": [ + {"helix": 16, "forward": false, "start": 184, "end": 192}, + {"helix": 17, "forward": true, "start": 184, "end": 200}, + {"helix": 18, "forward": false, "start": 192, "end": 200} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "AACAAATACCTGCCTATTTCGGAAGTGCCGTC", + "substrands": [ + {"helix": 3, "forward": true, "start": 208, "end": 216}, + {"helix": 2, "forward": false, "start": 200, "end": 216}, + {"helix": 1, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "ATCAGTAGCAGAACCGCCACCCTCTATTCACA", + "substrands": [ + {"helix": 5, "forward": true, "start": 208, "end": 216}, + {"helix": 4, "forward": false, "start": 200, "end": 216}, + {"helix": 3, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#f74308", + "dna_sequence": "GGCAACATTATCACCGTCACCGACGCACCGTA", + "substrands": [ + {"helix": 7, "forward": true, "start": 208, "end": 216}, + {"helix": 6, "forward": false, "start": 200, "end": 216}, + {"helix": 5, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "ACTGAACAGTTACCAGAAGGAAACATAAAGGT", + "substrands": [ + {"helix": 9, "forward": true, "start": 208, "end": 216}, + {"helix": 8, "forward": false, "start": 200, "end": 216}, + {"helix": 7, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#007200", + "dna_sequence": "TAATTTCATAGGGCTTAATTGAGAATTCTGTC", + "substrands": [ + {"helix": 15, "forward": true, "start": 208, "end": 216}, + {"helix": 14, "forward": false, "start": 200, "end": 216}, + {"helix": 13, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "TTTAATGGGAGAGACTACCTTTTTATTTTAGT", + "substrands": [ + {"helix": 17, "forward": true, "start": 208, "end": 216}, + {"helix": 16, "forward": false, "start": 200, "end": 216}, + {"helix": 15, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "AACGCGAGTATTATTTATCCCAATGAGAATTA", + "substrands": [ + {"helix": 11, "forward": true, "start": 208, "end": 216}, + {"helix": 10, "forward": false, "start": 200, "end": 216}, + {"helix": 9, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "CAGACGACTAAACCAAGTACCGCAATTCTAAG", + "substrands": [ + {"helix": 13, "forward": true, "start": 208, "end": 216}, + {"helix": 12, "forward": false, "start": 200, "end": 216}, + {"helix": 11, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#320096", + "dna_sequence": "AGGTTATCATCATTTTGCGGAACATCTGAATA", + "substrands": [ + {"helix": 21, "forward": true, "start": 208, "end": 216}, + {"helix": 20, "forward": false, "start": 200, "end": 216}, + {"helix": 19, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "AGCGTAAGACGCTGAGAGCCAGCAATTGAGGA", + "substrands": [ + {"helix": 23, "forward": true, "start": 208, "end": 216}, + {"helix": 22, "forward": false, "start": 200, "end": 216}, + {"helix": 21, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#333333", + "dna_sequence": "ATGGAAGGTACAAAATCGCGCAGATTACCTTT", + "substrands": [ + {"helix": 19, "forward": true, "start": 208, "end": 216}, + {"helix": 18, "forward": false, "start": 200, "end": 216}, + {"helix": 17, "forward": true, "start": 200, "end": 208} + ] + }, + { + "color": "#7300de", + "dna_sequence": "GAGAGGGTGAGTTTCGTCACCAGTACAAACTA", + "substrands": [ + {"helix": 1, "forward": true, "start": 208, "end": 216}, + {"helix": 0, "forward": false, "start": 192, "end": 216} + ] + }, + { + "color": "#888888", + "dna_sequence": "AAAATCTAGAGATAGAACCCTTCTGACCTGAA", + "substrands": [ + {"helix": 22, "forward": false, "start": 184, "end": 192}, + {"helix": 23, "forward": true, "start": 184, "end": 208} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "TAACACTTGATATAAGTATAGCAAACAGTT", + "substrands": [ + {"helix": 0, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 1, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 2, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "AATGCCCAATCCTCATTAAAGCCAGAGCCG", + "substrands": [ + {"helix": 2, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 3, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 4, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#f74308", + "dna_sequence": "CCACCCTCGACAGAATCAAGTTTCATTAAA", + "substrands": [ + {"helix": 4, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 5, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 6, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "GGTGAATATAAAAGAAACGCAAAGATAGCC", + "substrands": [ + {"helix": 6, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 7, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 8, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#007200", + "dna_sequence": "CGGGTATGACAATAAACAACATGCCAACGC", + "substrands": [ + {"helix": 12, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 13, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 14, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "TCAACAGTCTTCTGACCTAAATCAAAATCA", + "substrands": [ + {"helix": 14, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 15, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 16, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "GAACAAACCCTGAACAAAGTCACAAAATAA", + "substrands": [ + {"helix": 8, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 9, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 10, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "ACAGCCAGCGTTTTAGCGAACCTCCAAGAA", + "substrands": [ + {"helix": 10, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 11, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 12, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#320096", + "dna_sequence": "ACCAAGTGTTAGAACCTACCATAGTTTGAG", + "substrands": [ + {"helix": 18, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 19, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 20, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "TAACATTTAAAATATCTTTAGGGCCTGCAA", + "substrands": [ + {"helix": 20, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 21, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 22, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#333333", + "dna_sequence": "TAGGTCTAAACAGTACATAAATCTTTGAAT", + "substrands": [ + {"helix": 16, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 17, "forward": true, "start": 216, "end": 232, "deletions": [219]}, + {"helix": 18, "forward": false, "start": 224, "end": 232} + ] + }, + { + "color": "#7300de", + "dna_sequence": "AAAGCGCAGTAACAGTGCCCGTATCCGGAATA", + "substrands": [ + {"helix": 3, "forward": true, "start": 240, "end": 248}, + {"helix": 2, "forward": false, "start": 232, "end": 248}, + {"helix": 1, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#888888", + "dna_sequence": "GCGTCAGACCGGAACCGCCTCCCTCAGAATGG", + "substrands": [ + {"helix": 5, "forward": true, "start": 240, "end": 248}, + {"helix": 4, "forward": false, "start": 232, "end": 248}, + {"helix": 3, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "CGGAATAATATTGACGGAAATTATTGCCTTTA", + "substrands": [ + {"helix": 7, "forward": true, "start": 240, "end": 248}, + {"helix": 6, "forward": false, "start": 232, "end": 248}, + {"helix": 5, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "TTGAGCGCTTTAAGAAAAGTAAGCAGACACCA", + "substrands": [ + {"helix": 9, "forward": true, "start": 240, "end": 248}, + {"helix": 8, "forward": false, "start": 232, "end": 248}, + {"helix": 7, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#f74308", + "dna_sequence": "TTGAAATATTCTTACCAGTATAAAGTTCAGCT", + "substrands": [ + {"helix": 15, "forward": true, "start": 240, "end": 248}, + {"helix": 14, "forward": false, "start": 232, "end": 248}, + {"helix": 13, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "GTGAGTGATCAATAGTGAATTTATTTAATGGT", + "substrands": [ + {"helix": 17, "forward": true, "start": 240, "end": 248}, + {"helix": 16, "forward": false, "start": 232, "end": 248}, + {"helix": 15, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#007200", + "dna_sequence": "TGCGGGAGCCTAATTTGCCAGTTAGAGGGTAA", + "substrands": [ + {"helix": 11, "forward": true, "start": 240, "end": 248}, + {"helix": 10, "forward": false, "start": 232, "end": 248}, + {"helix": 9, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "AATGCAGATGTCTTTCCTTATCATTCCCGACT", + "substrands": [ + {"helix": 13, "forward": true, "start": 240, "end": 248}, + {"helix": 12, "forward": false, "start": 232, "end": 248}, + {"helix": 11, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "CAACTAATCGTTATTAATTTTAAAATCAAAAT", + "substrands": [ + {"helix": 21, "forward": true, "start": 240, "end": 248}, + {"helix": 20, "forward": false, "start": 232, "end": 248}, + {"helix": 19, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "TTGAATGGGGTCAGTATTAACACCAGCACTAA", + "substrands": [ + {"helix": 23, "forward": true, "start": 240, "end": 248}, + {"helix": 22, "forward": false, "start": 232, "end": 248}, + {"helix": 21, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#320096", + "dna_sequence": "TATTTGCACGGATTCGCCTGATTGCAATATAT", + "substrands": [ + {"helix": 19, "forward": true, "start": 240, "end": 248}, + {"helix": 18, "forward": false, "start": 232, "end": 248}, + {"helix": 17, "forward": true, "start": 232, "end": 240} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "GGTGTATCAGCCCAATAGGAACCCATGTACCG", + "substrands": [ + {"helix": 1, "forward": true, "start": 240, "end": 248}, + {"helix": 0, "forward": false, "start": 224, "end": 248} + ] + }, + { + "color": "#333333", + "dna_sequence": "CAGTGCCAATACGTGGCACAGACAATATTT", + "substrands": [ + {"helix": 22, "forward": false, "start": 216, "end": 224, "deletions": [219]}, + {"helix": 23, "forward": true, "start": 216, "end": 240, "deletions": [219]} + ] + }, + { + "color": "#7300de", + "dna_sequence": "GGATAGCAACCGTACTCAGGAGGTGGGGTCAG", + "substrands": [ + {"helix": 0, "forward": false, "start": 248, "end": 256}, + {"helix": 1, "forward": true, "start": 248, "end": 264}, + {"helix": 2, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#888888", + "dna_sequence": "TGCCTTGAGTCTCTGAATTTACCGGGAACCAG", + "substrands": [ + {"helix": 2, "forward": false, "start": 248, "end": 256}, + {"helix": 3, "forward": true, "start": 248, "end": 264}, + {"helix": 4, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "AGCCACCACTGTAGCGCGTTTTCAAGGGAGGG", + "substrands": [ + {"helix": 4, "forward": false, "start": 248, "end": 256}, + {"helix": 5, "forward": true, "start": 248, "end": 264}, + {"helix": 6, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "AAGGTAAAGTTTATTTTGTCACAATCTTACCG", + "substrands": [ + {"helix": 6, "forward": false, "start": 248, "end": 256}, + {"helix": 7, "forward": true, "start": 248, "end": 264}, + {"helix": 8, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#f74308", + "dna_sequence": "TAATCGGCACGCGCCTGTTTATCAATATGCGT", + "substrands": [ + {"helix": 12, "forward": false, "start": 248, "end": 256}, + {"helix": 13, "forward": true, "start": 248, "end": 264}, + {"helix": 14, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "TATACAAACCGACCGTGTGATAAAAAGACGCT", + "substrands": [ + {"helix": 14, "forward": false, "start": 248, "end": 256}, + {"helix": 15, "forward": true, "start": 248, "end": 264}, + {"helix": 16, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#007200", + "dna_sequence": "AAGCCCTTTAATATCAGAGAGATAGAGCGTCT", + "substrands": [ + {"helix": 8, "forward": false, "start": 248, "end": 256}, + {"helix": 9, "forward": true, "start": 248, "end": 264}, + {"helix": 10, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "TTCCAGAGGTTTTGAAGCCTTAAACCAATCAA", + "substrands": [ + {"helix": 10, "forward": false, "start": 248, "end": 256}, + {"helix": 11, "forward": true, "start": 248, "end": 264}, + {"helix": 12, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "AACAATAACGTAAAACAGAAATAAAAATCCTT", + "substrands": [ + {"helix": 18, "forward": false, "start": 248, "end": 256}, + {"helix": 19, "forward": true, "start": 248, "end": 264}, + {"helix": 20, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "TGCCCGAAAGATTAGAGCCGTCAAAAAACAGA", + "substrands": [ + {"helix": 20, "forward": false, "start": 248, "end": 256}, + {"helix": 21, "forward": true, "start": 248, "end": 264}, + {"helix": 22, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#320096", + "dna_sequence": "GAGAAGAGATAACCTTGCTTCTGTTCGGGAGA", + "substrands": [ + {"helix": 16, "forward": false, "start": 248, "end": 256}, + {"helix": 17, "forward": true, "start": 248, "end": 264}, + {"helix": 18, "forward": false, "start": 256, "end": 264} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "AAGCGTCAGTAATAAGTTTTAACTTAGTAC", + "substrands": [ + {"helix": 3, "forward": true, "start": 272, "end": 280}, + {"helix": 2, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 1, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#333333", + "dna_sequence": "TTTCGGTCATAATCAAAATCACCTTCCAGT", + "substrands": [ + {"helix": 5, "forward": true, "start": 272, "end": 280}, + {"helix": 4, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 3, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#7300de", + "dna_sequence": "AAAATTCAACATTCAACCGATTGTCGGCAT", + "substrands": [ + {"helix": 7, "forward": true, "start": 272, "end": 280}, + {"helix": 6, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 5, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#888888", + "dna_sequence": "AGAATTGAAAATAGCAATAGCTATCAATAG", + "substrands": [ + {"helix": 9, "forward": true, "start": 272, "end": 280}, + {"helix": 8, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 7, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "TTAAATAAAGCCTGTTTAGTATCACAATAG", + "substrands": [ + {"helix": 15, "forward": true, "start": 272, "end": 280}, + {"helix": 14, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 13, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "CGCTATTAGCGATAGCTTAGATTTAAGGCG", + "substrands": [ + {"helix": 17, "forward": true, "start": 272, "end": 280}, + {"helix": 16, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 15, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#f74308", + "dna_sequence": "TAGTTGCTCTTACCAACGCTAACACCCACA", + "substrands": [ + {"helix": 11, "forward": true, "start": 272, "end": 280}, + {"helix": 10, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 9, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "ATAAGTCCACGAGCATGTAGAAATCAAGAT", + "substrands": [ + {"helix": 13, "forward": true, "start": 272, "end": 280}, + {"helix": 12, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 11, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#007200", + "dna_sequence": "TACATTTGTCGACAACTCGTATTAGAAATT", + "substrands": [ + {"helix": 21, "forward": true, "start": 272, "end": 280}, + {"helix": 20, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 19, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "TGATAGCCCCACCAGCAGAAGATTAGATAA", + "substrands": [ + {"helix": 23, "forward": true, "start": 272, "end": 280}, + {"helix": 22, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 21, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "GCGTAGATACAGTACCTTTTACAAAATCGT", + "substrands": [ + {"helix": 19, "forward": true, "start": 272, "end": 280}, + {"helix": 18, "forward": false, "start": 264, "end": 280, "deletions": [267]}, + {"helix": 17, "forward": true, "start": 264, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "CGCCACCCAGAGCCACCACCCTCATTTTCAG", + "substrands": [ + {"helix": 1, "forward": true, "start": 272, "end": 280}, + {"helix": 0, "forward": false, "start": 256, "end": 280, "deletions": [267]} + ] + }, + { + "color": "#320096", + "dna_sequence": "GGTGAGGCCTATTAGTCTTTAATGCGCGAAC", + "substrands": [ + {"helix": 22, "forward": false, "start": 248, "end": 256}, + {"helix": 23, "forward": true, "start": 248, "end": 272, "deletions": [267]} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "CTTTCCAGCCGACAATGACAACTCGCTGAG", + "substrands": [ + {"helix": 0, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 1, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 2, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#333333", + "dna_sequence": "GCTTGCATTATACCAAGCGCGATGATAAAT", + "substrands": [ + {"helix": 2, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 3, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 4, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#7300de", + "dna_sequence": "TGTGTCGTGACGAGAAACACCAAATTTCAA", + "substrands": [ + {"helix": 4, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 5, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 6, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#888888", + "dna_sequence": "CTTTAATCGTTTACCAGACGACAAAGAAGT", + "substrands": [ + {"helix": 6, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 7, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 8, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "AGCATTAAAAGGCCGGAGACAGCTAGCTGA", + "substrands": [ + {"helix": 12, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 13, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 14, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "TAAATTAATTTTTGTTAAATCAAAATAATT", + "substrands": [ + {"helix": 14, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 15, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 16, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#f74308", + "dna_sequence": "TTTGCCATAATTCGAGCTTCAATCAGGATT", + "substrands": [ + {"helix": 8, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 9, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 10, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "AGAGAGTTATTTTCATTTGGGGATAGTAGT", + "substrands": [ + {"helix": 10, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 11, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 12, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#007200", + "dna_sequence": "CGATCGGCAATTCCACACAACAGGTGCCTA", + "substrands": [ + {"helix": 18, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 19, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 20, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "ATGAGTGCCCAGCAGGCGAAAAATCCCTTA", + "substrands": [ + {"helix": 20, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 21, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 22, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#03b6a2", + "dna_sequence": "CGCGTCTCGGAAACCAGGCAAAGGGAAGGG", + "substrands": [ + {"helix": 16, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 17, "forward": true, "start": 120, "end": 136, "deletions": [123]}, + {"helix": 18, "forward": false, "start": 128, "end": 136} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "GGCAGGTCATGAAAGTATTAAGAAGCGGGG", + "substrands": [ + {"helix": 3, "forward": true, "start": 176, "end": 184}, + {"helix": 2, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 1, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#320096", + "dna_sequence": "TCACCAATGAGCCGCCACCAGAAAGGTTGA", + "substrands": [ + {"helix": 5, "forward": true, "start": 176, "end": 184}, + {"helix": 4, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 3, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "TTAGCAAATTAGAGCCAGCAAAAGGAAACG", + "substrands": [ + {"helix": 7, "forward": true, "start": 176, "end": 184}, + {"helix": 6, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 5, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#333333", + "dna_sequence": "AAAACAGGTAACGGAATACCCAACAGTATG", + "substrands": [ + {"helix": 9, "forward": true, "start": 176, "end": 184}, + {"helix": 8, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 7, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#7300de", + "dna_sequence": "ACGCGAGAACGCCAACATGTAATAGAATAT", + "substrands": [ + {"helix": 15, "forward": true, "start": 176, "end": 184}, + {"helix": 14, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 13, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#888888", + "dna_sequence": "TTACATTTTGGGTTATATAACTAACAAAGA", + "substrands": [ + {"helix": 17, "forward": true, "start": 176, "end": 184}, + {"helix": 16, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 15, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#cc0000", + "dna_sequence": "TCAGATATTTTTTGTTTAACGTCTAACATA", + "substrands": [ + {"helix": 11, "forward": true, "start": 176, "end": 184}, + {"helix": 10, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 9, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#32b86c", + "dna_sequence": "AAAGTACCAAGCCGTTTTTATTTAAGCAAA", + "substrands": [ + {"helix": 13, "forward": true, "start": 176, "end": 184}, + {"helix": 12, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 11, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#f74308", + "dna_sequence": "TTGGCAAAGAGCGGAATTATCATTCAATAT", + "substrands": [ + {"helix": 21, "forward": true, "start": 176, "end": 184}, + {"helix": 20, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 19, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#57bb00", + "dna_sequence": "GGCCAACAAAGCATCACCTTGCTTGGTCAG", + "substrands": [ + {"helix": 23, "forward": true, "start": 176, "end": 184}, + {"helix": 22, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 21, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#007200", + "dna_sequence": "AATCCTGACAATTACCTGAGCAAAAATTAA", + "substrands": [ + {"helix": 19, "forward": true, "start": 176, "end": 184}, + {"helix": 18, "forward": false, "start": 168, "end": 184, "deletions": [171]}, + {"helix": 17, "forward": true, "start": 168, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#aaaa00", + "dna_sequence": "TAAATCAAGCCGGCGAACGTGGCGAGAAAG", + "substrands": [ + {"helix": 22, "forward": false, "start": 120, "end": 128, "deletions": [123]}, + {"helix": 23, "forward": true, "start": 120, "end": 144, "deletions": [123]} + ] + }, + { + "color": "#f7931e", + "dna_sequence": "GAAGGGAAACCAGTAATAAAAGGGACATTCT", + "substrands": [ + {"helix": 23, "forward": true, "start": 144, "end": 176, "deletions": [171]} + ] + }, + { + "color": "#320096", + "dna_sequence": "ATAGTTAGCGTAACGATCTAAAGTTTTGTCGT", + "substrands": [ + {"helix": 0, "forward": false, "start": 128, "end": 160} + ] + }, + { + "color": "#b8056c", + "dna_sequence": "TTTTGCTCGTAGCATTCCACAGACAGCCCTC", + "substrands": [ + {"helix": 1, "forward": true, "start": 176, "end": 184}, + {"helix": 0, "forward": false, "start": 160, "end": 184, "deletions": [171]} + ] + }, + { + "color": "#0066cc", + "dna_sequence": "TTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAATGCGAATTTTAACAAAATATTAACGTTTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTTGTTTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGATCTCTCAAAAATAGCTACCCTCTCCGGCATTAATTTATCAGCTAGAACGGTTGAATATCATATTGATGGTGATTTGACTGTCTCCGGCCTTTCTCACCCTTTTGAATCTTTACCTACACATTACTCAGGCATTGCATTTAAAATATATGAGGGTTCTAAAAATTTTTATCCTTGCGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGCTTTATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATTTATTGGATGTTAATGCTACTACTATTAGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCCAAATGAAAATATAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCTAATGGTCAAACTAAATCTACTCGTTCGCAGAATTGGGAATCAACTGTTATATGGAATGAAACTTCCAGACACCGTACTTTAGTTGCATATTTAAAACATGTTGAGCTACAGCATTATATTCAGCAATTAAGCTCTAAGCCATCCGCAAAAATGACCTCTTATCAAAAGGAGCAATTAAAGGTACTCTCTAATCCTGACCTGTTGGAGTTTGCTTCCGGTCTGGTTCGCTTTGAAGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAATATTTATGACGATTCCGCAGTATTGGACGCTATCCAGTCTAAACATTTTACTATTACCCCCTCTGGCAAAACTTCTTTTGCAAAAGCCTCTCGCTATTTTGGTTTTTATCGTCGTCTGGTAAACGAGGGTTATGATAGTGTTGCTCTTACTATGCCTCGTAATTCCTTTTGGCGTTATGTATCTGCATTAGTTGAATGTGGTATTCCTAAATCTCAACTGATGAATCTTTCTACCTGTAATAATGTTGTTCCGTTAGTTCGTTTTATTAACGTAGATTTTTCTTCCCAACGTCCTGACTGGTATAATGAGCCAGTTCTTAAAATCGCATAAGGTAATTCACAATGATTAAAGTTGAAATTAAACCATCTCAAGCCCAATTTACTACTCGTTCTGGTGTTTCTCGTCAGGGCAAGCCTTATTCACTGAATGAGCAGCTTTGTTACGTTGATTTGGGTAATGAATATCCGGTTCTTGTCAAGATTACTCTTGATGAAGGTCAGCCAGCCTATGCGCCTGGTCTGTACACCGTTCATCTGTCCTCTTTCAAAGTTGGTCAGTTCGGTTCCCTTATGATTGACCGTCTGCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGATGATACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGTCAAAGATGAGTGTTTTAGTGTATTCTTTTGCCTCTTTCGTTTTAGGTTGGTGCCTTCGTAGTGGCATTACGTATTTTACCCGTTTAATGGAAACTTCCTCATGAAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGCTACCCTCGTTCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAATTCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAAGTTGTTTAGCAAAATCCCATACAGAAAATTCATTTACTAACGTCTGGAAAGACGACAAAACTTTAGATCGTTACGCTAACTATGAGGGCTGTCTGTGGAATGCTACAGGCGTTGTAGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACATGGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTCCTGAGTACGGTGATACACCTATTCCGGGCTATACTTATATCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCTTCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATAGGTTCCGAAATAGGCAGGGGGCATTAACTGTTTATACGGGCACTGTTACTCAAGGCACTGACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATCAAAAGCCATGTATGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCTGGCTTTAATGAGGATTTATTTGTTTGTGAATATCAAGGCCAATCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGGTATTCCGTTATTATTGCGTTTCCTCGGTTTCCTTCTGGTAACTTTGTTCGGCTATCTGCTTACTTTTCTTAAAAAGGGCTTCGGTAAGATAGCTATTGCTATTTCATTGTTTCTTGCTCTTATTATTGGGCTTAACTCAATTCTTGTGGGTTATCTCTCTGATATTAGCGCTCAATTACCCTCTGACTTTGTTCAGGGTGTTCAGTTAATTCTCCCGTCTAATGCGCTTCCCTGTTTTTATGTTATTCTCTCTGTAAAGGCTGCTATTTTCATTTTTGACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATGGCTGTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAATAGCAACTAATCTTGATTTAAGGCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAACGCCTCGCGTTCTTAGAATACCGGATAAGCCTTCTATATCTGATTTGCTTGCTATTGGGCGCGGTAATGATTCCTACGATGAAAATAAAAACGGCTTGCTTGTTCTCGATGAGTGCGGTACTTGGTTTAATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTTGTTTATTGTCGTCGTCTGGACAGAATTACTTTACCTTTTGTCGGTACTTTATATTCTCTTATTACTGGCTCGAAAATGCCTCTGCCTAAATTACATGTTGGCGTTGTTAAATATGGCGATTCTCAATTAAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGAATTTGTATAACGCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATTCCGGTGTTTATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTCAAACCATTAAATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAAAGTTTTCTCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTTACATATAGTTATATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGACCTATGATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACGATTTACAGAAGCAAGGTTATTCACTCACATATATTGATTTATGTACTGTTTCCATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTTGTTTTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAATAATTCGCCTCTGCGCGATTTTGTAACTTGGTATTCAAAGCAATCAGGCGAATCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCATCTGACGTTAAACCTGAAAATCTACGCAATTTCTTTATTTCTGTTTTACGTGCAAATAATTTTGATATGGTAGGTTCTAACCCTTCCATTATTCAGAAGTATAATCCAAACAATCAGGATTATATTGATGAATTGCCATCATCTGATAATCAGGAATATGATGATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAAAATGATAATGTTACTCAAACTTTTAAAATTAATAACGTTCGGGCAAAGGATTTAATACGAGTTGTCGAATTGTTTGTAAAGTCTAATACTTCTAAATCCTCAAATGTATTATCTATTGACGGCTCTAATCTATTAGTTGTTAGTGCTCCTAAAGATATTTTAGATAACCTTCCTCAATTCCTTTCAACTGTTGATTTGCCAACTGACCAGATATTGATTGAGGGTTTGATATTTGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGTTGCAGGCGGTGTTAATACTGACCGCCTCACCTCTGTTTTATCTTCTGCTGGTGGTTCGTTCGGTATTTTTAATGGCGATGTTTTAGGGCTATCAGTTCGCGCATTAAAGACTAATAGCCATTCAAAAATATTGTCTGTGCCACGTATTCTTACGCTTTCAGGTCAGAAGGGTTCTATCTCTGTTGGCCAGAATGTCCCTTTTATTACTGGT", + "substrands": [ + {"helix": 23, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 22, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 21, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 20, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 19, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 18, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 17, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 16, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 15, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 14, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 13, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 12, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 11, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 10, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 9, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 8, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 7, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 6, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 5, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 4, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 3, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 2, "forward": true, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 1, "forward": false, "start": 8, "end": 152, "deletions": [27, 75, 123]}, + {"helix": 0, "forward": true, "start": 8, "end": 296, "deletions": [27, 75, 123, 171, 219, 267]}, + {"helix": 1, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 2, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 3, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 4, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 5, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 6, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 7, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 8, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 9, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 10, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 11, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 12, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 13, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 14, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 15, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 16, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 17, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 18, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 19, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 20, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 21, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 22, "forward": true, "start": 152, "end": 296, "deletions": [171, 219, 267]}, + {"helix": 23, "forward": false, "start": 152, "end": 296, "deletions": [171, 219, 267]} + ] + } + ] } \ No newline at end of file